Incidental Mutation 'R4565:A930011G23Rik'
ID343283
Institutional Source Beutler Lab
Gene Symbol A930011G23Rik
Ensembl Gene ENSMUSG00000089809
Gene NameRIKEN cDNA A930011G23 gene
Synonyms
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location99297244-99729065 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 99227947 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031276] [ENSMUST00000166484] [ENSMUST00000168092] [ENSMUST00000209346]
Predicted Effect probably benign
Transcript: ENSMUST00000031276
SMART Domains Protein: ENSMUSP00000031276
Gene: ENSMUSG00000089809

DomainStartEndE-ValueType
RasGEFN 33 157 5.22e-4 SMART
RasGEF 201 454 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166484
SMART Domains Protein: ENSMUSP00000128947
Gene: ENSMUSG00000089809

DomainStartEndE-ValueType
Blast:RasGEFN 33 123 6e-50 BLAST
RasGEF 159 412 3.26e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166632
Predicted Effect probably benign
Transcript: ENSMUST00000168092
SMART Domains Protein: ENSMUSP00000129652
Gene: ENSMUSG00000089809

DomainStartEndE-ValueType
RasGEFN 33 157 2.8e-4 SMART
RasGEF 200 453 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209346
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in A930011G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:A930011G23Rik APN 5 99243243 unclassified probably null
IGL00536:A930011G23Rik APN 5 99222383 missense probably damaging 1.00
IGL00848:A930011G23Rik APN 5 99222378 missense probably damaging 1.00
IGL01400:A930011G23Rik APN 5 99243101 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02427:A930011G23Rik APN 5 99233970 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02473:A930011G23Rik APN 5 99222995 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02609:A930011G23Rik APN 5 99233995 splice site probably benign
IGL02735:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02735:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02975:A930011G23Rik APN 5 99233925 missense possibly damaging 0.81
IGL03129:A930011G23Rik APN 5 99229379 missense probably damaging 0.98
IGL03139:A930011G23Rik APN 5 99243208 missense probably benign 0.00
IGL03239:A930011G23Rik APN 5 99233976 missense probably damaging 1.00
IGL03295:A930011G23Rik APN 5 99243056 splice site probably benign
R0011:A930011G23Rik UTSW 5 99232354 missense probably damaging 1.00
R0738:A930011G23Rik UTSW 5 99240953 missense probably benign 0.08
R0840:A930011G23Rik UTSW 5 99234688 missense probably benign 0.00
R1779:A930011G23Rik UTSW 5 99223038 splice site probably benign
R1799:A930011G23Rik UTSW 5 99234576 missense probably benign 0.01
R1992:A930011G23Rik UTSW 5 99233925 missense possibly damaging 0.81
R2054:A930011G23Rik UTSW 5 99228055 missense probably benign 0.01
R2157:A930011G23Rik UTSW 5 99232097 missense probably damaging 0.99
R2184:A930011G23Rik UTSW 5 99232369 missense possibly damaging 0.69
R4930:A930011G23Rik UTSW 5 99222404 missense possibly damaging 0.81
R5065:A930011G23Rik UTSW 5 99234573 missense probably benign 0.18
R5739:A930011G23Rik UTSW 5 99221430 missense probably damaging 1.00
R5806:A930011G23Rik UTSW 5 99240872 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCACTGCCTGAAGTCCAAC -3'
(R):5'- CATGATCTGGGAAGTTGAGAGC -3'

Sequencing Primer
(F):5'- TGCCTGAAGTCCAACCAACAC -3'
(R):5'- AGAGCTGAATGGTTAATGATGTTCTC -3'
Posted On2015-09-24