Incidental Mutation 'R4609:Brdt'
ID344505
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Namebromodomain, testis-specific
SynonymsFsrg3, 7420412D09Rik, Brd6
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4609 (G1)
Quality Score88
Status Not validated
Chromosome5
Chromosomal Location107331159-107387058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107359936 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 677 (A677T)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215]
PDB Structure
Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031215
AA Change: A677T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: A677T

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162804
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0585:Brdt UTSW 5 107356882 critical splice donor site probably null
R0708:Brdt UTSW 5 107358900 nonsense probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 synonymous probably null
R3121:Brdt UTSW 5 107377145 missense probably damaging 0.99
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGTTTTGCAGTGGAGAAG -3'
(R):5'- CAGGCCCAAGTCACATCCTTTC -3'

Sequencing Primer
(F):5'- GTGGAGAAGCCGCCCCC -3'
(R):5'- AGTCACATCCTTTCCTTCTTTTATGG -3'
Posted On2015-09-25