Incidental Mutation 'R4607:Pcdhga6'
ID346105
Institutional Source Beutler Lab
Gene Symbol Pcdhga6
Ensembl Gene ENSMUSG00000103793
Gene Nameprotocadherin gamma subfamily A, 6
Synonyms
MMRRC Submission 041818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4607 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37707039-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37708618 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 464 (N464D)
Ref Sequence ENSEMBL: ENSMUSP00000141803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157868
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195823
AA Change: N464D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793
AA Change: N464D

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 G T 5: 94,383,528 R90S probably benign Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adgra3 A C 5: 49,970,739 V800G probably damaging Het
Aldh1a1 A T 19: 20,621,687 Y154F probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Chrna9 A G 5: 65,976,735 I310V possibly damaging Het
Cpeb3 A G 19: 37,174,839 S46P possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlgap5 A G 14: 47,413,018 I151T possibly damaging Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
Erlin1 C T 19: 44,063,035 V76M probably damaging Het
Fam161a G A 11: 23,020,710 S296N probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm906 G A 13: 50,245,506 T928I possibly damaging Het
Gna14 A G 19: 16,533,711 probably null Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ipo11 A G 13: 106,900,811 S175P probably damaging Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Map3k2 T C 18: 32,199,977 L68P probably damaging Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Mink1 A G 11: 70,606,067 E417G possibly damaging Het
Myrf G T 19: 10,229,067 D29E probably damaging Het
Nelfcd T A 2: 174,423,162 D215E probably benign Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Olfr951 T C 9: 39,394,735 *312Q probably null Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdh9 T A 14: 93,015,573 N1218I probably benign Het
Rdx T A 9: 52,068,837 S243R probably damaging Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slit1 C A 19: 41,616,793 R873L probably benign Het
Strc T A 2: 121,372,945 I1130F probably benign Het
Tlk2 T A 11: 105,255,018 L350Q probably damaging Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,054 H53Q probably benign Het
Trbv24 T C 6: 41,218,401 probably benign Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp512b C A 2: 181,588,774 R441L probably damaging Het
Other mutations in Pcdhga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3551:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3552:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3688:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R3713:Pcdhga6 UTSW 18 37707923 missense probably damaging 0.99
R3832:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R3833:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R5594:Pcdhga6 UTSW 18 37708528 missense probably benign 0.40
R5608:Pcdhga6 UTSW 18 37707461 missense possibly damaging 0.50
R5887:Pcdhga6 UTSW 18 37708559 missense probably damaging 1.00
R6188:Pcdhga6 UTSW 18 37708271 missense probably benign 0.00
R6276:Pcdhga6 UTSW 18 37707644 missense probably benign 0.28
R6494:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R6619:Pcdhga6 UTSW 18 37709649 missense probably benign 0.00
R7145:Pcdhga6 UTSW 18 37707728 missense probably damaging 0.99
R7211:Pcdhga6 UTSW 18 37709120 missense probably benign 0.01
R7313:Pcdhga6 UTSW 18 37708019 missense possibly damaging 0.60
R7425:Pcdhga6 UTSW 18 37708566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACTGGATCGCGAACAG -3'
(R):5'- GACACATTGCTGCTAAGTGG -3'

Sequencing Primer
(F):5'- ATCGCGAACAGGTATCTTCG -3'
(R):5'- GGCTGTCACCAGTAGATTCAG -3'
Posted On2015-09-25