Incidental Mutation 'R4758:Rasa1'
ID358356
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene NameRAS p21 protein activator 1
Synonymsp120-rasGAP, Gap
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4758 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location85214780-85289130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85234448 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 446 (D446E)
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
Predicted Effect probably benign
Transcript: ENSMUST00000109552
AA Change: D446E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: D446E

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153231
Predicted Effect probably benign
Transcript: ENSMUST00000223598
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 unclassified probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4753:Rasa1 UTSW 13 85288390 splice site probably null
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5363:Rasa1 UTSW 13 85288555 missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6134:Rasa1 UTSW 13 85226626 missense probably benign 0.01
R6190:Rasa1 UTSW 13 85233695 missense probably benign 0.02
R6755:Rasa1 UTSW 13 85226598 missense possibly damaging 0.49
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTATGTGGAAGCTCTGAAC -3'
(R):5'- CCGGCATTTGTCCATGAGAC -3'

Sequencing Primer
(F):5'- GTGGAAGCTCTGAACAAATACTTG -3'
(R):5'- CCATGAGACATTGTTCTTAAGAAATG -3'
Posted On2015-11-11