Mutagenetix > Incidental Mutation

Incidental Mutation 'R4850:Dsp'

373489

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

DP, 2300002E22Rik, 5730453H04Rik, rul

MMRRC Submission

042462-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38335270-38382553 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 38376445 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1410 (L1410H)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000124830
AA Change: L1410H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: L1410H

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.0650

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 124,709,429 (GRCm39)	A42T	probably benign	Het
Acsf3	T	C	8: 123,544,175 (GRCm39)	V551A	probably damaging	Het
Adgrl2	G	A	3: 148,564,656 (GRCm39)	T304I	probably damaging	Het
Akr1d1	A	G	6: 37,531,522 (GRCm39)		probably null	Het
Ankrd17	A	T	5: 90,412,645 (GRCm39)	H1226Q	probably damaging	Het
Arap1	T	C	7: 101,047,998 (GRCm39)	I847T	probably damaging	Het
Atad2b	G	A	12: 4,993,251 (GRCm39)	G257S	probably benign	Het
Cand2	A	T	6: 115,778,909 (GRCm39)	T1158S	probably benign	Het
Cic	G	A	7: 24,972,327 (GRCm39)	R686H	probably damaging	Het
Cldn1	T	A	16: 26,181,913 (GRCm39)	T99S	probably benign	Het
Cnga3	G	T	1: 37,297,087 (GRCm39)	E173*	probably null	Het
Cplane1	T	C	15: 8,292,422 (GRCm39)	S3012P	unknown	Het
Cryge	G	T	1: 65,090,211 (GRCm39)		probably benign	Het
Dync2h1	T	C	9: 7,134,364 (GRCm39)	T1548A	probably benign	Het
Dysf	C	A	6: 84,074,697 (GRCm39)	D499E	probably damaging	Het
Eml5	T	C	12: 98,756,878 (GRCm39)	D1917G	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Fn3krp	A	T	11: 121,315,879 (GRCm39)	H90L	possibly damaging	Het
Garin2	A	G	12: 78,761,927 (GRCm39)	D197G	probably damaging	Het
Gm10718	A	T	9: 3,023,716 (GRCm39)	T56S	probably benign	Het
Gm4847	A	T	1: 166,469,908 (GRCm39)	I55K	probably damaging	Het
Gsn	T	A	2: 35,173,912 (GRCm39)		probably null	Het
H2bc11	G	T	13: 22,227,421 (GRCm39)		probably benign	Het
Haghl	T	C	17: 26,001,980 (GRCm39)		probably benign	Het
Hmg20b	T	A	10: 81,182,761 (GRCm39)	E139V	probably damaging	Het
Hsd3b6	G	A	3: 98,715,221 (GRCm39)	T57I	probably benign	Het
Igkv5-48	A	G	6: 69,703,780 (GRCm39)	S42P	probably damaging	Het
Igsf23	T	C	7: 19,687,859 (GRCm39)		probably benign	Het
Kcnt1	T	C	2: 25,798,112 (GRCm39)	F874L	probably damaging	Het
Maf1	T	C	15: 76,237,162 (GRCm39)	F110L	possibly damaging	Het
Mtpap	C	T	18: 4,387,044 (GRCm39)	R365W	probably damaging	Het
Mtus1	A	C	8: 41,537,507 (GRCm39)	S70A	possibly damaging	Het
Nfatc1	T	A	18: 80,741,080 (GRCm39)	T307S	probably benign	Het
Nphs1	T	G	7: 30,162,657 (GRCm39)	S379A	possibly damaging	Het
Nup205	A	G	6: 35,207,465 (GRCm39)	T1506A	probably benign	Het
Or13f5	T	C	4: 52,825,450 (GRCm39)	S18P	possibly damaging	Het
Or8u9	T	A	2: 86,002,015 (GRCm39)	I49F	probably damaging	Het
Pcdhga8	A	T	18: 37,860,762 (GRCm39)	Y606F	probably damaging	Het
Pde7a	A	G	3: 19,297,281 (GRCm39)	V123A	probably benign	Het
Pex1	C	T	5: 3,674,426 (GRCm39)	T809I	probably benign	Het
Prdm13	C	A	4: 21,678,243 (GRCm39)	R749L	possibly damaging	Het
Prkcd	A	G	14: 30,321,700 (GRCm39)	L498P	probably damaging	Het
Pros1	A	T	16: 62,705,887 (GRCm39)	E67V	probably damaging	Het
Rab44	A	G	17: 29,359,063 (GRCm39)	E417G	possibly damaging	Het
Rangrf	A	G	11: 68,864,466 (GRCm39)		probably null	Het
Rp1	T	A	1: 4,418,898 (GRCm39)	K738M	probably damaging	Het
Ryr2	A	T	13: 11,683,706 (GRCm39)	D3119E	probably damaging	Het
Ryr2	G	A	13: 11,760,638 (GRCm39)	R1482C	probably damaging	Het
Sbspon	T	A	1: 15,929,192 (GRCm39)	T200S	probably damaging	Het
Sfxn5	T	C	6: 85,309,358 (GRCm39)		probably benign	Het
Slc26a8	T	A	17: 28,873,857 (GRCm39)	I377F	probably benign	Het
Slc30a7	A	G	3: 115,786,657 (GRCm39)	F72L	probably damaging	Het
Slc32a1	T	C	2: 158,456,112 (GRCm39)	F256L	possibly damaging	Het
Slco6b1	T	C	1: 96,839,558 (GRCm39)		noncoding transcript	Het
Smpd1	A	G	7: 105,205,192 (GRCm39)	H357R	probably benign	Het
Sncaip	A	T	18: 53,004,456 (GRCm39)	H361L	probably damaging	Het
Tenm2	A	C	11: 35,914,315 (GRCm39)	Y2406*	probably null	Het
Terb1	T	A	8: 105,212,057 (GRCm39)	H308L	probably benign	Het
Trim61	A	T	8: 65,466,070 (GRCm39)	L397H	probably damaging	Het
Trp53bp1	T	A	2: 121,035,594 (GRCm39)		probably null	Het
Ttn	T	G	2: 76,611,899 (GRCm39)	E9007D	possibly damaging	Het
Urb1	A	T	16: 90,592,302 (GRCm39)	C319*	probably null	Het
Vmn2r95	T	C	17: 18,671,915 (GRCm39)	Y551H	probably damaging	Het
Vwde	A	T	6: 13,196,047 (GRCm39)	V326D	possibly damaging	Het
Xdh	A	G	17: 74,205,330 (GRCm39)	L1045P	probably damaging	Het
Zfp638	T	C	6: 83,956,457 (GRCm39)	I1688T	possibly damaging	Het
Zwint	T	A	10: 72,491,788 (GRCm39)		probably benign	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38,381,822 (GRCm39)	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38,376,663 (GRCm39)	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38,377,593 (GRCm39)	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38,351,547 (GRCm39)	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38,360,471 (GRCm39)	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38,363,060 (GRCm39)	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38,365,162 (GRCm39)	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38,380,499 (GRCm39)	nonsense	probably null
IGL02833:Dsp	APN	13	38,376,897 (GRCm39)	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38,372,421 (GRCm39)	splice site	probably benign
IGL03353:Dsp	APN	13	38,370,671 (GRCm39)	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38,381,340 (GRCm39)	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38,381,340 (GRCm39)	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38,379,993 (GRCm39)	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38,381,681 (GRCm39)	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38,371,869 (GRCm39)	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38,371,869 (GRCm39)	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38,356,770 (GRCm39)	missense	probably benign
R0326:Dsp	UTSW	13	38,376,846 (GRCm39)	nonsense	probably null
R0332:Dsp	UTSW	13	38,366,204 (GRCm39)	nonsense	probably null
R0471:Dsp	UTSW	13	38,377,326 (GRCm39)	nonsense	probably null
R0567:Dsp	UTSW	13	38,376,414 (GRCm39)	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38,371,717 (GRCm39)	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38,380,740 (GRCm39)	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38,367,194 (GRCm39)	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38,367,082 (GRCm39)	splice site	probably benign
R1183:Dsp	UTSW	13	38,375,716 (GRCm39)	nonsense	probably null
R1188:Dsp	UTSW	13	38,378,939 (GRCm39)	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38,370,671 (GRCm39)	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38,375,907 (GRCm39)	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38,376,688 (GRCm39)	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38,376,688 (GRCm39)	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38,365,114 (GRCm39)	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38,359,123 (GRCm39)	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38,379,714 (GRCm39)	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38,377,350 (GRCm39)	nonsense	probably null
R1736:Dsp	UTSW	13	38,376,966 (GRCm39)	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38,380,593 (GRCm39)	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38,377,171 (GRCm39)	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38,348,831 (GRCm39)	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38,375,434 (GRCm39)	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38,380,427 (GRCm39)	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38,360,383 (GRCm39)	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38,381,022 (GRCm39)	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38,377,453 (GRCm39)	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38,380,380 (GRCm39)	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38,376,224 (GRCm39)	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38,377,318 (GRCm39)	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38,361,175 (GRCm39)	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38,381,594 (GRCm39)	missense	probably benign	0.00
R3725:Dsp	UTSW	13	38,378,665 (GRCm39)	splice site	probably null
R3797:Dsp	UTSW	13	38,361,260 (GRCm39)	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38,381,681 (GRCm39)	missense	probably benign
R4030:Dsp	UTSW	13	38,375,404 (GRCm39)	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38,370,689 (GRCm39)	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38,369,207 (GRCm39)	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38,380,640 (GRCm39)	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38,379,108 (GRCm39)	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38,375,608 (GRCm39)	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38,352,617 (GRCm39)	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38,380,760 (GRCm39)	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38,375,595 (GRCm39)	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38,380,016 (GRCm39)	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38,379,080 (GRCm39)	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38,351,504 (GRCm39)	nonsense	probably null
R4830:Dsp	UTSW	13	38,376,840 (GRCm39)	missense	probably benign
R4959:Dsp	UTSW	13	38,375,686 (GRCm39)	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38,381,846 (GRCm39)	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38,376,886 (GRCm39)	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38,366,210 (GRCm39)	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38,381,678 (GRCm39)	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38,381,678 (GRCm39)	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38,379,821 (GRCm39)	missense	possibly damaging	0.50
R5138:Dsp	UTSW	13	38,367,274 (GRCm39)	missense	probably benign	0.37
R5153:Dsp	UTSW	13	38,366,282 (GRCm39)	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38,376,878 (GRCm39)	nonsense	probably null
R5226:Dsp	UTSW	13	38,370,746 (GRCm39)	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38,379,159 (GRCm39)	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38,378,865 (GRCm39)	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38,368,014 (GRCm39)	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38,379,818 (GRCm39)	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38,376,628 (GRCm39)	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38,351,477 (GRCm39)	splice site	probably null
R5910:Dsp	UTSW	13	38,376,445 (GRCm39)	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38,379,410 (GRCm39)	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38,380,002 (GRCm39)	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38,379,377 (GRCm39)	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38,378,934 (GRCm39)	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38,379,678 (GRCm39)	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38,351,585 (GRCm39)	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38,376,023 (GRCm39)	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38,376,382 (GRCm39)	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38,380,982 (GRCm39)	nonsense	probably null
R6527:Dsp	UTSW	13	38,379,849 (GRCm39)	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38,380,838 (GRCm39)	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38,351,598 (GRCm39)	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38,376,186 (GRCm39)	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38,376,193 (GRCm39)	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38,351,631 (GRCm39)	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38,351,622 (GRCm39)	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38,370,683 (GRCm39)	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38,375,716 (GRCm39)	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38,363,049 (GRCm39)	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38,379,569 (GRCm39)	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38,372,511 (GRCm39)	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38,377,524 (GRCm39)	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38,376,859 (GRCm39)	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38,381,501 (GRCm39)	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38,356,819 (GRCm39)	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38,381,172 (GRCm39)	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38,379,425 (GRCm39)	missense	probably benign	0.00
R7439:Dsp	UTSW	13	38,360,478 (GRCm39)	critical splice donor site	probably null
R7441:Dsp	UTSW	13	38,379,425 (GRCm39)	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38,356,839 (GRCm39)	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38,376,765 (GRCm39)	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38,352,742 (GRCm39)	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38,375,691 (GRCm39)	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38,375,458 (GRCm39)	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38,359,183 (GRCm39)	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38,369,151 (GRCm39)	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38,375,446 (GRCm39)	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38,367,994 (GRCm39)	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38,351,615 (GRCm39)	nonsense	probably null
R7971:Dsp	UTSW	13	38,376,499 (GRCm39)	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38,352,600 (GRCm39)	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38,376,786 (GRCm39)	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38,381,319 (GRCm39)	missense	probably benign
R8323:Dsp	UTSW	13	38,356,806 (GRCm39)	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38,375,611 (GRCm39)	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38,376,457 (GRCm39)	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38,380,791 (GRCm39)	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38,369,117 (GRCm39)	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38,352,701 (GRCm39)	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38,381,502 (GRCm39)	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38,365,155 (GRCm39)	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38,365,155 (GRCm39)	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38,335,596 (GRCm39)	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38,376,700 (GRCm39)	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38,380,808 (GRCm39)	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38,352,673 (GRCm39)	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38,377,276 (GRCm39)	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38,377,126 (GRCm39)	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38,377,337 (GRCm39)	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38,376,379 (GRCm39)	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38,377,218 (GRCm39)	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38,371,781 (GRCm39)	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38,367,937 (GRCm39)	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38,379,494 (GRCm39)	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38,381,660 (GRCm39)	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38,377,231 (GRCm39)	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38,370,622 (GRCm39)	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38,366,288 (GRCm39)	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38,381,166 (GRCm39)	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38,376,830 (GRCm39)	frame shift	probably null
Z1177:Dsp	UTSW	13	38,335,665 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GATCGAAAGGCTCAAAGCTG -3'
(R):5'- TCAGTTCGCATCTGAGTGACC -3'

Sequencing Primer
(F):5'- CTCAAAGCTGAGTATCAGGAGG -3'
(R):5'- CATCTGAGTGACCTGTCGGAG -3'

Posted On

2016-03-01