Incidental Mutation 'R5075:Cep85'
ID386918
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Namecentrosomal protein 85
Synonyms2410030J07Rik, Ccdc21
MMRRC Submission 042664-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R5075 (G1)
Quality Score206
Status Validated
Chromosome4
Chromosomal Location134129858-134187112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 134132367 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 662 (D662Y)
Ref Sequence ENSEMBL: ENSMUSP00000113351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030651] [ENSMUST00000040271] [ENSMUST00000070246] [ENSMUST00000105879] [ENSMUST00000121566]
Predicted Effect probably benign
Transcript: ENSMUST00000030651
SMART Domains Protein: ENSMUSP00000030651
Gene: ENSMUSG00000028843

DomainStartEndE-ValueType
Pfam:SH3BGR 2 93 6.3e-40 PFAM
Pfam:Glutaredoxin 22 70 9.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040271
AA Change: D664Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: D664Y

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070246
SMART Domains Protein: ENSMUSP00000064030
Gene: ENSMUSG00000012126

DomainStartEndE-ValueType
Pfam:SEP 114 185 1.5e-20 PFAM
UBX 268 350 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105879
Predicted Effect probably damaging
Transcript: ENSMUST00000121566
AA Change: D662Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: D662Y

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138144
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,052 K1016E probably damaging Het
Agl A G 3: 116,793,807 F33S probably damaging Het
Atf7ip A G 6: 136,560,234 D163G probably benign Het
Cntn6 T A 6: 104,833,030 S558T probably damaging Het
Dnah8 T C 17: 30,739,757 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnah8 T A 17: 30,800,531 N3859K probably damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Esm1 A G 13: 113,213,358 Y104C probably damaging Het
Fkbp15 T C 4: 62,321,029 K613R probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,158,963 probably benign Het
Hdac4 A G 1: 91,996,120 S223P probably benign Het
Hypk A G 2: 121,455,630 probably benign Het
Kpna1 T A 16: 36,009,352 F70I probably damaging Het
Lrp2 A G 2: 69,465,758 Y3336H probably benign Het
Mettl7b A G 10: 128,960,680 F87L probably damaging Het
Mier1 A G 4: 103,139,473 D99G probably benign Het
Muc4 T C 16: 32,754,794 probably benign Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1480 T A 19: 13,530,273 M244K probably benign Het
Peg3 A T 7: 6,708,420 C1268S probably damaging Het
Recql4 G A 15: 76,709,544 P122L probably damaging Het
Rex2 A T 4: 147,057,694 Q213L possibly damaging Het
Rnf25 A G 1: 74,595,644 V73A probably benign Het
Sacm1l A G 9: 123,582,262 D372G probably benign Het
Selplg T C 5: 113,819,984 D87G probably benign Het
Sgsh G A 11: 119,346,768 T340M probably benign Het
Slc4a3 A T 1: 75,557,368 I1120F probably damaging Het
Snrnp40 T C 4: 130,388,582 Y311H probably benign Het
Stard7 A T 2: 127,269,959 probably benign Het
Stat1 A T 1: 52,122,712 K40M possibly damaging Het
Sun1 T C 5: 139,226,891 probably null Het
Tet2 T A 3: 133,486,906 Q589L probably benign Het
Tmc7 A T 7: 118,552,696 probably null Het
Unc79 A T 12: 103,074,954 I749F possibly damaging Het
Ust A G 10: 8,518,224 F59S probably damaging Het
Wdr81 A T 11: 75,452,481 D653E probably benign Het
Zfat A G 15: 68,180,230 S572P probably benign Het
Zmynd15 G C 11: 70,462,120 E143D probably damaging Het
Zzef1 A G 11: 72,858,344 E886G probably damaging Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 134148761 missense possibly damaging 0.63
IGL01397:Cep85 APN 4 134156206 missense probably damaging 1.00
IGL01472:Cep85 APN 4 134134166 missense possibly damaging 0.55
IGL01522:Cep85 APN 4 134152255 missense probably damaging 1.00
IGL01522:Cep85 APN 4 134152256 missense probably damaging 1.00
IGL02004:Cep85 APN 4 134167387 missense probably damaging 1.00
IGL02043:Cep85 APN 4 134155727 missense probably benign 0.02
IGL02187:Cep85 APN 4 134131305 missense possibly damaging 0.86
IGL02317:Cep85 APN 4 134155811 missense probably damaging 1.00
IGL02543:Cep85 APN 4 134156323 missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 134156264 missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 134148697 missense probably damaging 1.00
R0060:Cep85 UTSW 4 134167300 missense probably damaging 1.00
R0068:Cep85 UTSW 4 134154295 missense probably benign 0.00
R0346:Cep85 UTSW 4 134132422 missense probably damaging 1.00
R0462:Cep85 UTSW 4 134131421 missense possibly damaging 0.88
R1295:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1296:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1472:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1577:Cep85 UTSW 4 134152288 missense probably damaging 1.00
R1681:Cep85 UTSW 4 134148728 nonsense probably null
R1687:Cep85 UTSW 4 134148013 missense probably benign 0.00
R2031:Cep85 UTSW 4 134132450 missense probably benign 0.00
R2216:Cep85 UTSW 4 134131430 missense possibly damaging 0.62
R2220:Cep85 UTSW 4 134153867 missense probably damaging 1.00
R4321:Cep85 UTSW 4 134132285 missense probably damaging 1.00
R4888:Cep85 UTSW 4 134164751 intron probably benign
R5044:Cep85 UTSW 4 134156179 missense probably damaging 0.97
R5627:Cep85 UTSW 4 134134097 missense probably damaging 1.00
R6841:Cep85 UTSW 4 134155856 missense probably benign
R6842:Cep85 UTSW 4 134155856 missense probably benign
R6843:Cep85 UTSW 4 134155856 missense probably benign
R6981:Cep85 UTSW 4 134152261 missense probably damaging 1.00
V8831:Cep85 UTSW 4 134156069 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACACGAGAAGATGGAGACCTTC -3'
(R):5'- TGGAGAACATGGCACCAAGC -3'

Sequencing Primer
(F):5'- GATGGAGACCTTCTGATGACTCAC -3'
(R):5'- AGAGACATTGTCTGGGGCTCC -3'
Posted On2016-06-06