Incidental Mutation 'R5069:Cdh3'
ID388552
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106536826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 126 (N126S)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080797]
PDB Structure
Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080797
AA Change: N126S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: N126S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
PIT4486001:Cdh3 UTSW 8 106541490 missense possibly damaging 0.89
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0462:Cdh3 UTSW 8 106555380 missense possibly damaging 0.65
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1495:Cdh3 UTSW 8 106538997 missense probably damaging 1.00
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R1806:Cdh3 UTSW 8 106536915 missense probably benign 0.02
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R4928:Cdh3 UTSW 8 106536610 missense probably benign 0.15
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R5408:Cdh3 UTSW 8 106536637 missense probably damaging 0.98
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6637:Cdh3 UTSW 8 106511341 missense probably benign
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCGCATCTTAAGGAGACGAAAG -3'
(R):5'- GTCTACACTGGGAGCTAAAGG -3'

Sequencing Primer
(F):5'- TATTCGTCCCCGAGAATGGCAAG -3'
(R):5'- GCTAAAGGCTATTTACCTCGTACTTG -3'
Posted On2016-06-06