Incidental Mutation 'R1806:Cdh3'
ID203471
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1806 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106536915 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080797]
PDB Structure
Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080797
AA Change: S156P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: S156P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0462:Cdh3 UTSW 8 106555380 missense possibly damaging 0.65
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1495:Cdh3 UTSW 8 106538997 missense probably damaging 1.00
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R4928:Cdh3 UTSW 8 106536610 missense probably benign 0.15
R5069:Cdh3 UTSW 8 106536826 missense probably benign 0.19
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R5408:Cdh3 UTSW 8 106536637 missense probably damaging 0.98
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6637:Cdh3 UTSW 8 106511341 missense probably benign
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- GGTCTGCAGGATTTATCGTCCG -3'
(R):5'- GGCACCATTCTCAGATACAGC -3'

Sequencing Primer
(F):5'- CCTAAGAGGAAGGCTTCTTGC -3'
(R):5'- ATTCTCAGATACAGCGTGGC -3'
Posted On2014-06-23