Incidental Mutation 'R5291:Senp7'
ID405169
Institutional Source Beutler Lab
Gene Symbol Senp7
Ensembl Gene ENSMUSG00000052917
Gene NameSUMO1/sentrin specific peptidase 7
Synonyms
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R5291 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location56048338-56190012 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 56186179 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 982 (Y982*)
Ref Sequence ENSEMBL: ENSMUSP00000086779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089360] [ENSMUST00000089362]
Predicted Effect probably null
Transcript: ENSMUST00000089360
AA Change: Y955*
SMART Domains Protein: ENSMUSP00000086776
Gene: ENSMUSG00000052917
AA Change: Y955*

DomainStartEndE-ValueType
low complexity region 165 181 N/A INTRINSIC
low complexity region 352 376 N/A INTRINSIC
low complexity region 386 395 N/A INTRINSIC
low complexity region 639 646 N/A INTRINSIC
Pfam:Peptidase_C48 734 999 7.8e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089362
AA Change: Y982*
SMART Domains Protein: ENSMUSP00000086779
Gene: ENSMUSG00000052917
AA Change: Y982*

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 666 673 N/A INTRINSIC
Pfam:Peptidase_C48 761 1026 8.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202272
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a SUMO deconjugating enzyme of the Sentrin/SUMO-specific protease (SENP) family. The encoded protein is a protease that exhibits deSUMOylating activity towards proteins involved in chromatin remodeling and promotes chromatin relaxation for DNA repair or transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,585,937 S328G probably damaging Het
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Mkln1 T A 6: 31,490,481 N43K possibly damaging Het
Olfr1259 A T 2: 89,943,436 Y226* probably null Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Scarf1 T C 11: 75,524,074 S525P probably damaging Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Spred3 T A 7: 29,167,830 H47L probably damaging Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in Senp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Senp7 APN 16 56082377 missense probably damaging 0.96
IGL01610:Senp7 APN 16 56175823 missense possibly damaging 0.94
IGL01627:Senp7 APN 16 56171856 missense probably damaging 1.00
IGL02748:Senp7 APN 16 56186094 missense probably damaging 1.00
IGL03031:Senp7 APN 16 56175886 missense probably damaging 1.00
IGL03083:Senp7 APN 16 56171865 missense probably benign 0.28
R0034:Senp7 UTSW 16 56153570 missense possibly damaging 0.63
R0200:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0547:Senp7 UTSW 16 56175826 missense probably damaging 1.00
R0608:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R1595:Senp7 UTSW 16 56184768 missense probably damaging 1.00
R1737:Senp7 UTSW 16 56123799 missense probably damaging 1.00
R1837:Senp7 UTSW 16 56158516 missense probably benign 0.01
R1945:Senp7 UTSW 16 56123946 missense probably damaging 0.98
R2143:Senp7 UTSW 16 56169806 missense probably benign
R2275:Senp7 UTSW 16 56184783 missense probably damaging 1.00
R2508:Senp7 UTSW 16 56151362 missense probably benign 0.28
R3404:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3405:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3717:Senp7 UTSW 16 56179057 splice site probably benign
R3885:Senp7 UTSW 16 56186079 missense probably damaging 1.00
R4159:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4160:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4161:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4512:Senp7 UTSW 16 56165883 missense probably damaging 1.00
R5315:Senp7 UTSW 16 56180526 missense probably benign 0.26
R5390:Senp7 UTSW 16 56169916 missense probably benign
R5424:Senp7 UTSW 16 56186108 missense possibly damaging 0.82
R5643:Senp7 UTSW 16 56184149 splice site silent
R5644:Senp7 UTSW 16 56184149 splice site silent
R5645:Senp7 UTSW 16 56173208 missense possibly damaging 0.80
R5799:Senp7 UTSW 16 56139105 splice site probably null
R5860:Senp7 UTSW 16 56155359 missense possibly damaging 0.49
R5954:Senp7 UTSW 16 56169871 missense probably benign 0.04
R6164:Senp7 UTSW 16 56169754 missense probably damaging 1.00
R6280:Senp7 UTSW 16 56162375 missense possibly damaging 0.62
R6647:Senp7 UTSW 16 56173255 missense probably damaging 1.00
R6652:Senp7 UTSW 16 56123894 missense probably benign 0.08
R7310:Senp7 UTSW 16 56186082 missense probably benign 0.18
U24488:Senp7 UTSW 16 56184819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACAGTGGCATTTATGAAGGCTC -3'
(R):5'- AGGTCACTGTGGTCTCCATG -3'

Sequencing Primer
(F):5'- CCTTTGTAGAAAGTGTTGCTGAC -3'
(R):5'- GGTCACTGTGGTCTCCATGTCTTC -3'
Posted On2016-07-22