Incidental Mutation 'R5315:Gm42669'
ID405788
Institutional Source Beutler Lab
Gene Symbol Gm42669
Ensembl Gene ENSMUSG00000106631
Gene Namepredicted gene 42669
Synonyms
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107507621-107580596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107508237 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1301 (I1301F)
Ref Sequence ENSEMBL: ENSMUSP00000148277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060553] [ENSMUST00000100951] [ENSMUST00000112671] [ENSMUST00000152474] [ENSMUST00000160160] [ENSMUST00000211896]
Predicted Effect probably benign
Transcript: ENSMUST00000060553
Predicted Effect probably benign
Transcript: ENSMUST00000100951
AA Change: I789F

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098511
Gene: ENSMUSG00000111375
AA Change: I789F

DomainStartEndE-ValueType
low complexity region 340 353 N/A INTRINSIC
low complexity region 698 709 N/A INTRINSIC
low complexity region 946 957 N/A INTRINSIC
Pfam:DUF4596 1195 1239 2.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112671
AA Change: I789F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108290
Gene: ENSMUSG00000111375
AA Change: I789F

DomainStartEndE-ValueType
low complexity region 340 353 N/A INTRINSIC
low complexity region 698 709 N/A INTRINSIC
low complexity region 946 957 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133800
Predicted Effect unknown
Transcript: ENSMUST00000143074
AA Change: I206F
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631
AA Change: I206F

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152474
SMART Domains Protein: ENSMUSP00000114881
Gene: ENSMUSG00000111375

DomainStartEndE-ValueType
low complexity region 339 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160160
SMART Domains Protein: ENSMUSP00000124398
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
Pfam:DUF4580 10 140 1.5e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211896
AA Change: I1301F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Gm42669
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0384:Gm42669 UTSW 5 107508798 missense probably benign 0.00
R1554:Gm42669 UTSW 5 107507787 missense possibly damaging 0.86
R1797:Gm42669 UTSW 5 107507817 nonsense probably null
R1956:Gm42669 UTSW 5 107508872 missense possibly damaging 0.46
R1957:Gm42669 UTSW 5 107508872 missense possibly damaging 0.46
R2091:Gm42669 UTSW 5 107507910 missense probably benign 0.13
R4634:Gm42669 UTSW 5 107508213 missense possibly damaging 0.85
R4912:Gm42669 UTSW 5 107508817 missense probably damaging 1.00
R7014:Gm42669 UTSW 5 107508276 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGATGAGGGCTCACACGAC -3'
(R):5'- CTGAACCTGCTGAGTACCTG -3'

Sequencing Primer
(F):5'- CGACAGAGGCATCTCCAAGTG -3'
(R):5'- AACCTGCTGAGTACCTGAGCTG -3'
Posted On2016-07-22