Incidental Mutation 'R5423:Kdm4a'
ID426694
Institutional Source Beutler Lab
Gene Symbol Kdm4a
Ensembl Gene ENSMUSG00000033326
Gene Namelysine (K)-specific demethylase 4A
SynonymsJmjd2, D4Ertd222e, JHDM3A, Jmjd2a
MMRRC Submission 042989-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R5423 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118136957-118180043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118138908 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 975 (A975T)
Ref Sequence ENSEMBL: ENSMUSP00000102014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000050288] [ENSMUST00000097911] [ENSMUST00000097912] [ENSMUST00000106403] [ENSMUST00000106406] [ENSMUST00000106410]
Predicted Effect probably benign
Transcript: ENSMUST00000030263
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050288
SMART Domains Protein: ENSMUSP00000062910
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.87e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097911
AA Change: A975T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095524
Gene: ENSMUSG00000033326
AA Change: A975T

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097912
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106403
AA Change: A975T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102011
Gene: ENSMUSG00000033326
AA Change: A975T

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106406
AA Change: A975T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102014
Gene: ENSMUSG00000033326
AA Change: A975T

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106410
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein containing a JmjN domain, a JmjC domain, a JD2H domain, two TUDOR domains, and two PHD-type zinc fingers. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form, and as a transcriptional repressor. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Gpr17 G A 18: 31,947,641 T123I probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Inhbc C G 10: 127,357,427 C240S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Serpina3g A G 12: 104,237,994 probably benign Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Uggt2 G A 14: 119,019,486 T1112I probably damaging Het
Vasn C T 16: 4,648,420 P77L probably benign Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Kdm4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kdm4a APN 4 118160501 missense probably damaging 1.00
IGL01845:Kdm4a APN 4 118160459 missense possibly damaging 0.85
IGL02009:Kdm4a APN 4 118160169 missense probably benign 0.01
IGL02296:Kdm4a APN 4 118177465 missense probably damaging 1.00
IGL02366:Kdm4a APN 4 118160506 critical splice acceptor site probably null
IGL02606:Kdm4a APN 4 118160289 missense probably benign 0.00
IGL02673:Kdm4a APN 4 118168572 missense probably benign 0.00
R0245:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0326:Kdm4a UTSW 4 118161706 missense probably benign 0.00
R0551:Kdm4a UTSW 4 118138231 makesense probably null
R0603:Kdm4a UTSW 4 118142511 missense probably damaging 1.00
R0652:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0799:Kdm4a UTSW 4 118146992 splice site probably null
R0847:Kdm4a UTSW 4 118164498 missense probably damaging 0.96
R1307:Kdm4a UTSW 4 118175642 missense probably benign 0.02
R1572:Kdm4a UTSW 4 118138949 missense possibly damaging 0.89
R1869:Kdm4a UTSW 4 118138871 missense probably null 1.00
R1902:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R1903:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R2135:Kdm4a UTSW 4 118142459 missense probably damaging 1.00
R3856:Kdm4a UTSW 4 118153231 missense probably damaging 1.00
R4687:Kdm4a UTSW 4 118144083 missense probably damaging 1.00
R4940:Kdm4a UTSW 4 118161754 missense probably benign 0.00
R5115:Kdm4a UTSW 4 118162581 missense possibly damaging 0.75
R5229:Kdm4a UTSW 4 118146605 missense probably damaging 0.99
R5305:Kdm4a UTSW 4 118160501 missense probably damaging 1.00
R5750:Kdm4a UTSW 4 118142199 intron probably benign
R5849:Kdm4a UTSW 4 118161840 missense probably benign 0.17
R5876:Kdm4a UTSW 4 118138876 missense probably damaging 0.98
R6564:Kdm4a UTSW 4 118177439 missense probably benign 0.18
R6772:Kdm4a UTSW 4 118142555 critical splice acceptor site probably null
R6982:Kdm4a UTSW 4 118153439 intron probably null
Predicted Primers PCR Primer
(F):5'- GATACCCCAGATCTGTGAAGG -3'
(R):5'- TTTGACGGACCGTACCTTGG -3'

Sequencing Primer
(F):5'- TCTGTGAAGGCACTAAGTGACC -3'
(R):5'- GGACCGTACCTTGGCTTTCAG -3'
Posted On2016-09-01