Incidental Mutation 'R5401:Cracr2b'
ID429991
Institutional Source Beutler Lab
Gene Symbol Cracr2b
Ensembl Gene ENSMUSG00000048200
Gene Namecalcium release activated channel regulator 2B
SynonymsEfcab4a, 6330520A15Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141461094-141466613 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 141466223 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 395 (*395W)
Ref Sequence ENSEMBL: ENSMUSP00000055899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053670] [ENSMUST00000058746] [ENSMUST00000106000] [ENSMUST00000165194] [ENSMUST00000167491] [ENSMUST00000170879] [ENSMUST00000172215] [ENSMUST00000177840] [ENSMUST00000209892] [ENSMUST00000209988] [ENSMUST00000211071]
Predicted Effect probably null
Transcript: ENSMUST00000053670
AA Change: *395W
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200
AA Change: *395W

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058746
SMART Domains Protein: ENSMUSP00000061636
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect probably benign
Transcript: ENSMUST00000106000
SMART Domains Protein: ENSMUSP00000101622
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163833
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably benign
Transcript: ENSMUST00000167491
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167900
Predicted Effect probably benign
Transcript: ENSMUST00000170879
SMART Domains Protein: ENSMUSP00000129946
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171994
Predicted Effect probably benign
Transcript: ENSMUST00000172215
SMART Domains Protein: ENSMUSP00000132793
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177840
SMART Domains Protein: ENSMUSP00000136331
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209698
Predicted Effect probably benign
Transcript: ENSMUST00000209892
Predicted Effect probably benign
Transcript: ENSMUST00000209988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210308
Predicted Effect probably benign
Transcript: ENSMUST00000211071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211564
Meta Mutation Damage Score 0.6456 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Cracr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cracr2b APN 7 141465757 unclassified probably benign
IGL02092:Cracr2b APN 7 141464956 missense probably damaging 0.96
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0324:Cracr2b UTSW 7 141463746 missense probably damaging 1.00
R0453:Cracr2b UTSW 7 141464263 missense probably damaging 0.96
R0569:Cracr2b UTSW 7 141464935 unclassified probably benign
R1386:Cracr2b UTSW 7 141463568 missense probably damaging 1.00
R2061:Cracr2b UTSW 7 141465280 missense probably damaging 0.96
R3605:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R3607:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R4674:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R4675:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R6174:Cracr2b UTSW 7 141464836 missense probably damaging 1.00
R7127:Cracr2b UTSW 7 141465782 missense possibly damaging 0.73
R7132:Cracr2b UTSW 7 141463738 missense probably benign 0.30
R7303:Cracr2b UTSW 7 141463202 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTGAATCTGAGGCTTCG -3'
(R):5'- GGCCTTTATTGGTCCTTCAGAC -3'

Sequencing Primer
(F):5'- CTGAATCTGAGGCTTCGAGATGAG -3'
(R):5'- CTTAGCAAGTATCCGCCA -3'
Posted On2016-09-06