Incidental Mutation 'R5403:1700061G19Rik'
List |< first << previous [record 80 of 18188] next >> last >|
ID430141
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
MMRRC Submission 042974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5403 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 56876221 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048] [ENSMUST00000043062]
Predicted Effect probably benign
Transcript: ENSMUST00000025048
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043062
SMART Domains Protein: ENSMUSP00000042352
Gene: ENSMUSG00000024207

DomainStartEndE-ValueType
Pfam:AMP-binding 53 519 7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125425
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A G 13: 104,352,815 D392G possibly damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Alkbh8 A G 9: 3,385,318 K537E probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Bpifb4 A T 2: 153,943,992 I17F probably damaging Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Ccdc88b T A 19: 6,857,740 T38S unknown Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Cdr2 G A 7: 120,958,745 Q186* probably null Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntnap3 G A 13: 64,761,978 T771I possibly damaging Het
Cops8 C T 1: 90,606,620 probably benign Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Ddx50 A G 10: 62,647,030 S87P probably benign Het
Dlg2 A G 7: 92,431,002 T598A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epha6 A T 16: 59,775,570 D919E probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fndc9 C T 11: 46,237,714 S20L probably benign Het
Gpx6 A G 13: 21,317,643 E145G probably damaging Het
Hc A G 2: 35,057,434 Y23H probably damaging Het
Jmy G T 13: 93,441,396 Q755K probably benign Het
Krtap4-7 A T 11: 99,643,714 S108T unknown Het
Mgat5b T G 11: 116,948,657 I333S probably benign Het
Mkl2 A G 16: 13,401,013 T519A probably damaging Het
Naip6 G A 13: 100,300,077 A646V probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Olfr936 G T 9: 39,046,703 P239T probably damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otogl T A 10: 107,808,756 M1210L probably benign Het
Phf24 A T 4: 42,933,831 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Rad50 A G 11: 53,695,281 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
St5 A G 7: 109,556,905 S213P probably damaging Het
Tbcd C A 11: 121,560,743 N546K probably damaging Het
Tenm4 A G 7: 96,888,827 D1832G probably damaging Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ube2o A T 11: 116,548,807 I179N possibly damaging Het
Usp17le T C 7: 104,769,234 I234V probably damaging Het
Zfp106 T C 2: 120,534,781 T382A probably benign Het
Zfp607a A G 7: 27,879,319 K605E possibly damaging Het
Zmynd10 T A 9: 107,550,586 L363H possibly damaging Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0604:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2247:1700061G19Rik UTSW 17 56877435 missense possibly damaging 0.83
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R2917:1700061G19Rik UTSW 17 56885141 missense probably damaging 1.00
R3149:1700061G19Rik UTSW 17 56876348 missense probably benign
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5043:1700061G19Rik UTSW 17 56885198 missense probably damaging 1.00
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6754:1700061G19Rik UTSW 17 56883358 missense probably damaging 0.99
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
Predicted Primers
Posted On2016-09-06