Incidental Mutation 'R0481:Mib2'
ID43353
Institutional Source Beutler Lab
Gene Symbol Mib2
Ensembl Gene ENSMUSG00000029060
Gene Namemindbomb E3 ubiquitin protein ligase 2
Synonyms2210008I11Rik, Zzank1
MMRRC Submission 038681-MU
Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0481 (G1)
Quality Score100
Status Validated
Chromosome4
Chromosomal Location155654677-155669198 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 155656062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000103176] [ENSMUST00000141108]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103176
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect probably benign
Transcript: ENSMUST00000141108
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156906
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Mib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Mib2 APN 4 155657730 missense probably damaging 1.00
IGL01404:Mib2 APN 4 155654936 missense probably damaging 1.00
IGL01819:Mib2 APN 4 155655258 unclassified probably null
IGL02147:Mib2 APN 4 155657687 missense probably benign
IGL02260:Mib2 APN 4 155661171 missense probably damaging 1.00
IGL02472:Mib2 APN 4 155656746 missense probably damaging 1.00
IGL02632:Mib2 APN 4 155655579 missense probably damaging 0.98
IGL03051:Mib2 APN 4 155657290 missense probably damaging 1.00
IGL03077:Mib2 APN 4 155659443 missense probably benign 0.01
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0115:Mib2 UTSW 4 155656062 unclassified probably benign
R0193:Mib2 UTSW 4 155655673 missense probably benign
R0279:Mib2 UTSW 4 155661216 missense possibly damaging 0.89
R0373:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R0563:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0564:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0625:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0714:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0740:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0942:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0987:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1023:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1033:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1037:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1460:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1481:Mib2 UTSW 4 155656999 missense probably benign 0.01
R1712:Mib2 UTSW 4 155654799 missense probably damaging 1.00
R2015:Mib2 UTSW 4 155657880 missense probably damaging 1.00
R2072:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R2131:Mib2 UTSW 4 155655238 unclassified probably null
R2187:Mib2 UTSW 4 155654933 missense possibly damaging 0.95
R3751:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3752:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3753:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R4381:Mib2 UTSW 4 155657612 missense possibly damaging 0.55
R4584:Mib2 UTSW 4 155657287 missense probably damaging 1.00
R4669:Mib2 UTSW 4 155657415 missense possibly damaging 0.49
R4754:Mib2 UTSW 4 155655365 missense possibly damaging 0.90
R4782:Mib2 UTSW 4 155659772 missense probably benign 0.00
R4799:Mib2 UTSW 4 155659772 missense probably benign 0.00
R5036:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R5073:Mib2 UTSW 4 155656776 missense probably damaging 1.00
R5915:Mib2 UTSW 4 155656051 unclassified probably benign
R6695:Mib2 UTSW 4 155661172 missense probably damaging 1.00
R7039:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R7234:Mib2 UTSW 4 155657893 missense probably damaging 1.00
X0012:Mib2 UTSW 4 155655395 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTGGGCTACCCCAGAAAGCTGAAC -3'
(R):5'- GCTGTGATGTGAATGTGCGGAACC -3'

Sequencing Primer
(F):5'- GTGCAGAAACTCTGAGATCCTTC -3'
(R):5'- TGTGCGGAACCGGAAGC -3'
Posted On2013-05-23