Incidental Mutation 'R5535:Amer2'
List |< first << previous [record 40 of 585] next >> last >|
ID434793
Institutional Source Beutler Lab
Gene Symbol Amer2
Ensembl Gene ENSMUSG00000021986
Gene NameAPC membrane recruitment 2
SynonymsFam123a, 2600011E07Rik, Amer2
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5535 (G1)
Quality Score103
Status Not validated
Chromosome14
Chromosomal Location60373259-60388197 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AAGGAGGAGGAGGAG to AAGGAGGAGGAG at 60378853 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022561] [ENSMUST00000224957] [ENSMUST00000225247]
Predicted Effect probably benign
Transcript: ENSMUST00000022561
SMART Domains Protein: ENSMUSP00000022561
Gene: ENSMUSG00000021986

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:WTX 57 554 5.2e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224957
Predicted Effect probably benign
Transcript: ENSMUST00000225247
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P146Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Amer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Amer2 APN 14 60379907 missense possibly damaging 0.82
IGL03306:Amer2 APN 14 60378552 missense probably damaging 1.00
IGL03382:Amer2 APN 14 60379882 missense possibly damaging 0.77
R0365:Amer2 UTSW 14 60379535 missense probably damaging 0.99
R0433:Amer2 UTSW 14 60378583 missense probably damaging 0.99
R1696:Amer2 UTSW 14 60379674 missense possibly damaging 0.93
R1754:Amer2 UTSW 14 60379757 missense probably damaging 1.00
R1991:Amer2 UTSW 14 60379820 missense probably damaging 0.96
R2018:Amer2 UTSW 14 60378445 missense probably damaging 1.00
R2423:Amer2 UTSW 14 60379207 missense possibly damaging 0.81
R3160:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R3161:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R3162:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R4928:Amer2 UTSW 14 60379445 missense possibly damaging 0.92
R4981:Amer2 UTSW 14 60379727 missense probably damaging 1.00
R5212:Amer2 UTSW 14 60379820 missense probably damaging 0.96
R5685:Amer2 UTSW 14 60379577 nonsense probably null
R6002:Amer2 UTSW 14 60378782 missense possibly damaging 0.93
R6247:Amer2 UTSW 14 60378872 missense probably damaging 0.96
R6408:Amer2 UTSW 14 60380225 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCTGCGTTCAAGTTATTCAAG -3'
(R):5'- TCACCTGTCTTGGACGCATC -3'

Sequencing Primer
(F):5'- GCTGCGTTCAAGTTATTCAAGAAAAG -3'
(R):5'- GGAGCTTTGATCGCCAGAG -3'
Posted On2016-10-24