Incidental Mutation 'R5608:Lrrc31'
ID439374
Institutional Source Beutler Lab
Gene Symbol Lrrc31
Ensembl Gene ENSMUSG00000074653
Gene Nameleucine rich repeat containing 31
Synonyms
MMRRC Submission 043272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5608 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30679058-30699843 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 30689845 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108263] [ENSMUST00000126658]
Predicted Effect probably null
Transcript: ENSMUST00000108263
SMART Domains Protein: ENSMUSP00000103898
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.5e-2 SMART
Blast:LRR 148 175 1e-8 BLAST
LRR 176 203 2.6e-1 SMART
LRR 204 231 6.7e-2 SMART
LRR 260 287 1e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126658
SMART Domains Protein: ENSMUSP00000120802
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.4e-2 SMART
Blast:LRR 148 175 2e-8 BLAST
LRR 176 203 2.5e-1 SMART
LRR 204 231 6.5e-2 SMART
LRR 260 287 9.9e-2 SMART
Pfam:LRR_6 288 307 8.2e-1 PFAM
LRR 372 399 8e-3 SMART
LRR 402 430 2.7e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133653
Meta Mutation Damage Score 0.6412 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,048 Q1017R probably damaging Het
Adamtsl5 T C 10: 80,342,947 D199G probably benign Het
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Adgrv1 T C 13: 81,155,276 E117G probably damaging Het
Alkbh7 A T 17: 56,998,446 I88F probably damaging Het
Ankrd26 C A 6: 118,511,622 D1359Y probably damaging Het
Apoo-ps T C 13: 107,414,209 noncoding transcript Het
Arfgap2 G A 2: 91,270,202 R298H probably damaging Het
Birc6 G A 17: 74,613,544 V2109I probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Bpifa1 T C 2: 154,147,575 probably benign Het
Capn7 A G 14: 31,370,707 Y737C probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Colec12 T A 18: 9,848,267 D148E possibly damaging Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Dpysl4 T C 7: 139,098,543 V473A probably damaging Het
Dyrk3 T C 1: 131,128,715 S574G probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Helq C T 5: 100,790,219 G454S probably damaging Het
Incenp CGCTGCTGCTGC CGCTGCTGCTGCTGC 19: 9,893,868 probably benign Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Ltbp2 A C 12: 84,787,464 probably null Het
Marcks A T 10: 37,136,916 V41E probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Nhlrc3 C T 3: 53,462,311 probably null Het
Olfr145 G A 9: 37,897,782 C126Y probably damaging Het
Olfr353 A G 2: 36,890,515 F111S probably damaging Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Pcdhga6 A G 18: 37,707,461 N78S possibly damaging Het
Plag1 T A 4: 3,905,463 K76* probably null Het
Ptpn21 T A 12: 98,688,777 T644S probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Rnf157 A T 11: 116,396,320 probably null Het
Serpina5 A C 12: 104,103,744 Y300S probably damaging Het
Slc41a3 A G 6: 90,640,907 K279R probably benign Het
Smndc1 A G 19: 53,383,653 V110A probably benign Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Utrn A T 10: 12,671,837 S1620T probably benign Het
Xkr4 T C 1: 3,671,380 probably benign Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Lrrc31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03110:Lrrc31 APN 3 30679266 missense probably benign 0.04
R0285:Lrrc31 UTSW 3 30684948 missense probably benign 0.02
R0348:Lrrc31 UTSW 3 30689228 missense probably benign 0.14
R0418:Lrrc31 UTSW 3 30689234 missense probably damaging 1.00
R0453:Lrrc31 UTSW 3 30687525 missense probably damaging 1.00
R0613:Lrrc31 UTSW 3 30685035 splice site probably benign
R2243:Lrrc31 UTSW 3 30685030 splice site probably benign
R2248:Lrrc31 UTSW 3 30689901 missense possibly damaging 0.95
R4093:Lrrc31 UTSW 3 30695522 missense probably damaging 1.00
R4781:Lrrc31 UTSW 3 30687377 intron probably benign
R4805:Lrrc31 UTSW 3 30691297 nonsense probably null
R4835:Lrrc31 UTSW 3 30679157 missense probably damaging 0.97
R4893:Lrrc31 UTSW 3 30679297 missense probably benign 0.02
R4936:Lrrc31 UTSW 3 30689268 missense probably damaging 1.00
R5063:Lrrc31 UTSW 3 30689936 missense possibly damaging 0.78
R5135:Lrrc31 UTSW 3 30684890 nonsense probably null
R5527:Lrrc31 UTSW 3 30691228 missense probably damaging 1.00
R5607:Lrrc31 UTSW 3 30689845 splice site probably null
R5611:Lrrc31 UTSW 3 30691155 critical splice donor site probably null
R5865:Lrrc31 UTSW 3 30679140 missense probably benign 0.01
R6001:Lrrc31 UTSW 3 30691169 missense possibly damaging 0.68
X0027:Lrrc31 UTSW 3 30689279 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACAGAGCATCCAGGAGCTTC -3'
(R):5'- GGTGCCCTTGAAATGACACC -3'

Sequencing Primer
(F):5'- ATCACAGGCTTCTGCAGAGAGTC -3'
(R):5'- CTGAACTCGAAGAACTAAGTCTGTCG -3'
Posted On2016-10-26