Incidental Mutation 'H8786:Rptn'
ID44429
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93397873 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 838 (T838A)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045912
AA Change: T838A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: T838A

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCACACTGGCATCGGACAGAC -3'
(R):5'- GGCTCTTGCTGTACCTGAGCTAAG -3'

Sequencing Primer
(F):5'- CAGACAAGGACAGAGTTTTCATTATG -3'
(R):5'- ACTCTGGGTTTGACGCAC -3'
Posted On2013-06-11