Mutagenetix > Incidental Mutation

Incidental Mutation 'R5738:Cbfb'

444627

Institutional Source

Beutler Lab

Gene Symbol

Cbfb

Ensembl Gene

ENSMUSG00000031885

Gene Name

core binding factor beta

Synonyms

Pebpb2, PEA2, PEBP2b, Pebp2

MMRRC Submission

043350-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105897306-105944621 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 105929193 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 170 (Q170P)

Ref Sequence

ENSEMBL: ENSMUSP00000105019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052209] [ENSMUST00000109392] [ENSMUST00000109394] [ENSMUST00000109395]

AlphaFold

Q08024

Predicted Effect

probably benign
Transcript: ENSMUST00000052209

SMART Domains

Protein: ENSMUSP00000059382
Gene: ENSMUSG00000031885

Domain	Start	End	E-Value	Type
Pfam:CBF_beta	1	168	8.4e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109392
AA Change: Q170P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105019
Gene: ENSMUSG00000031885
AA Change: Q170P

Domain	Start	End	E-Value	Type
Pfam:CBF_beta	1	177	7.9e-86	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109394

SMART Domains

Protein: ENSMUSP00000105021
Gene: ENSMUSG00000031885

Domain	Start	End	E-Value	Type
Pfam:CBF_beta	1	59	2.7e-32	PFAM
Pfam:CBF_beta	53	139	1.5e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109395

SMART Domains

Protein: ENSMUSP00000105022
Gene: ENSMUSG00000031885

Domain	Start	End	E-Value	Type
Pfam:CBF_beta	1	141	4.3e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122762

Meta Mutation Damage Score

0.1593

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the beta subunit of a heterodimeric core-binding transcription factor belonging to the PEBP2/CBF transcription factor family which master-regulates a host of genes specific to hematopoiesis (e.g., RUNX1) and osteogenesis (e.g., RUNX2). The beta subunit is a non-DNA binding regulatory subunit; it allosterically enhances DNA binding by alpha subunit as the complex binds to the core site of various enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers and GM-CSF promoters. Alternative splicing generates two mRNA variants, each encoding a distinct carboxyl terminus. In some cases, a pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript consisting of the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain 11. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit massive CNS hemorrhaging, impaired definitive hematopoiesis, and death around E12.5. Homozygotes for a hypoplastic mutation are born at normal ratios but die soon after birth. Delayed skeletal development leaves bones poorly ossified and hypoplastic at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,571,917 (GRCm39)	D4826V	probably damaging	Het
Acoxl	G	A	2: 127,719,686 (GRCm39)	C149Y	probably benign	Het
Adamts3	G	T	5: 89,856,527 (GRCm39)	H349N	probably damaging	Het
Ap2b1	A	G	11: 83,227,256 (GRCm39)		probably null	Het
Ap3m2	T	C	8: 23,293,877 (GRCm39)	S58G	possibly damaging	Het
Bhmt2	A	T	13: 93,799,798 (GRCm39)	W213R	probably benign	Het
Cacna1h	T	G	17: 25,606,023 (GRCm39)	D1092A	probably damaging	Het
Ccdc73	A	C	2: 104,761,331 (GRCm39)	K110N	possibly damaging	Het
Cep350	C	A	1: 155,741,824 (GRCm39)	R2149L	probably damaging	Het
Cog2	A	G	8: 125,272,777 (GRCm39)	T525A	probably benign	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Fbxl5	A	G	5: 43,920,170 (GRCm39)	I251T	probably benign	Het
Fscn3	A	G	6: 28,430,030 (GRCm39)	K67E	possibly damaging	Het
Glmp	T	A	3: 88,233,445 (GRCm39)	N133K	probably benign	Het
Gpr179	T	C	11: 97,242,232 (GRCm39)	N204S	probably damaging	Het
Gtf2ird1	C	T	5: 134,412,672 (GRCm39)	R613Q	probably damaging	Het
Hepacam	A	G	9: 37,294,721 (GRCm39)	D285G	possibly damaging	Het
Hipk4	G	A	7: 27,227,841 (GRCm39)	V196M	probably damaging	Het
Hlx	A	T	1: 184,463,754 (GRCm39)		probably null	Het
Igf2r	A	T	17: 12,936,254 (GRCm39)	D597E	probably benign	Het
Ighm	T	C	12: 113,385,115 (GRCm39)	T282A	unknown	Het
Igsf9b	T	C	9: 27,239,826 (GRCm39)	C624R	probably damaging	Het
Ksr2	T	C	5: 117,886,864 (GRCm39)	V800A	probably damaging	Het
Lyn	A	T	4: 3,782,987 (GRCm39)	I386F	probably damaging	Het
Melk	A	G	4: 44,310,333 (GRCm39)	D102G	probably damaging	Het
Mettl1	G	T	10: 126,877,863 (GRCm39)	E4*	probably null	Het
Mybl2	C	T	2: 162,910,203 (GRCm39)	Q210*	probably null	Het
Naga	C	T	15: 82,219,054 (GRCm39)	W231*	probably null	Het
Or2y3	T	C	17: 38,393,347 (GRCm39)	Y174C	probably damaging	Het
Or4k2	C	T	14: 50,424,105 (GRCm39)	V190I	probably benign	Het
Or7g16	T	C	9: 18,727,125 (GRCm39)	N155S	possibly damaging	Het
Otud4	T	C	8: 80,400,090 (GRCm39)	S935P	probably benign	Het
P2rx7	C	T	5: 122,790,852 (GRCm39)	T63I	probably damaging	Het
Pga5	A	T	19: 10,647,024 (GRCm39)	N260K	probably benign	Het
Phka2	ACC	AC	X: 159,342,862 (GRCm39)		probably null	Het
Plch1	T	A	3: 63,681,076 (GRCm39)	R184W	probably damaging	Het
Ppm1b	T	C	17: 85,301,374 (GRCm39)	F85L	probably benign	Het
Prtg	T	A	9: 72,819,288 (GRCm39)	F1094I	probably benign	Het
Ralgds	G	A	2: 28,432,538 (GRCm39)		probably benign	Het
Rgs17	A	C	10: 5,783,140 (GRCm39)	V149G	probably damaging	Het
Rnf168	A	G	16: 32,101,192 (GRCm39)	E124G	probably damaging	Het
Sav1	T	C	12: 70,022,817 (GRCm39)	E245G	possibly damaging	Het
Slc25a19	T	C	11: 115,515,060 (GRCm39)	I33V	probably benign	Het
Sptbn1	T	C	11: 30,095,941 (GRCm39)	I318V	probably damaging	Het
Tas2r136	A	G	6: 132,754,707 (GRCm39)	L140P	probably damaging	Het
Tbc1d9	A	G	8: 83,997,655 (GRCm39)	I1071V	probably benign	Het
Tecta	G	T	9: 42,284,474 (GRCm39)	N870K	possibly damaging	Het
Tmem230	G	A	2: 132,086,048 (GRCm39)	P38L	possibly damaging	Het
Trpa1	G	T	1: 14,946,174 (GRCm39)	H986N	probably damaging	Het
Wdr41	A	T	13: 95,114,996 (GRCm39)	I24L	possibly damaging	Het

Other mutations in Cbfb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02037:Cbfb	APN	8	105,905,252 (GRCm39)	missense	possibly damaging	0.94
IGL02296:Cbfb	APN	8	105,905,312 (GRCm39)	missense	probably damaging	1.00
R7923:Cbfb	UTSW	8	105,921,225 (GRCm39)	critical splice donor site	probably null
R9483:Cbfb	UTSW	8	105,929,123 (GRCm39)	nonsense	probably null
R9621:Cbfb	UTSW	8	105,905,243 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCTGAAATTAGTGCGGGATG -3'
(R):5'- ATGCTGAGCCATCTCTTCAG -3'

Sequencing Primer
(F):5'- AAGAATTACTCTTCGGTTGGATTC -3'
(R):5'- GATGGCTCACACCTGTATCCTAG -3'

Posted On

2016-11-21