Incidental Mutation 'R5764:Utp4'
ID446176
Institutional Source Beutler Lab
Gene Symbol Utp4
Ensembl Gene ENSMUSG00000041438
Gene NameUTP4 small subunit processome component
SynonymsTex292, TEG-292, Cirh1a
MMRRC Submission 043365-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.981) question?
Stock #R5764 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106893636-106923088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 106917616 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 529 (V529G)
Ref Sequence ENSEMBL: ENSMUSP00000048377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047629
AA Change: V529G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048377
Gene: ENSMUSG00000041438
AA Change: V529G

DomainStartEndE-ValueType
WD40 5 44 6.19e-1 SMART
WD40 48 87 1.48e1 SMART
WD40 90 129 5.39e-5 SMART
WD40 134 172 1.48e-2 SMART
WD40 185 222 7.96e0 SMART
WD40 225 264 3.55e1 SMART
WD40 276 313 7.96e0 SMART
Blast:WD40 378 417 2e-19 BLAST
WD40 426 465 8.25e0 SMART
WD40 470 512 3.99e-1 SMART
WD40 515 554 2.22e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212718
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD40-repeat-containing protein that is localized to the nucleolus. Mutation of this gene causes North American Indian childhood cirrhosis, a severe intrahepatic cholestasis that results in transient neonatal jaundice, and progresses to periportal fibrosis and cirrhosis in childhood and adolescence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,541,574 V536I possibly damaging Het
Arap2 T C 5: 62,642,854 T1277A probably damaging Het
Cep85l A T 10: 53,348,994 D166E probably benign Het
Cope T C 8: 70,306,581 S125P probably damaging Het
Dzip3 A G 16: 48,927,361 probably benign Het
Endou G A 15: 97,714,607 R253C probably damaging Het
Entpd1 A T 19: 40,738,973 probably null Het
Fam160a1 A G 3: 85,665,865 Y926H probably damaging Het
Grk3 A G 5: 112,966,910 probably null Het
Hba-a2 T A 11: 32,297,156 probably null Het
Hecw1 C T 13: 14,322,509 V305I probably damaging Het
Hspg2 C A 4: 137,561,721 T3735K probably damaging Het
Htr4 G A 18: 62,437,542 A223T probably damaging Het
Iglv1 T C 16: 19,085,440 I7M unknown Het
Jag1 C T 2: 137,089,247 C655Y probably damaging Het
Jmjd1c C T 10: 67,226,512 T1548I probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Klra6 T A 6: 130,022,729 Q92L possibly damaging Het
Lrp1 T C 10: 127,595,318 N325S probably benign Het
Ly75 C T 2: 60,318,439 R1182H probably benign Het
Map2 T C 1: 66,414,875 S975P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mpdz A G 4: 81,356,446 F180L probably benign Het
Myadm G A 7: 3,297,252 V177I possibly damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nup153 A G 13: 46,687,327 M255T probably damaging Het
Pgm2 C T 4: 99,964,846 A303V probably damaging Het
Pgr A T 9: 8,900,537 I24F probably benign Het
Pigq A T 17: 25,932,119 I412N probably damaging Het
Plod2 A G 9: 92,603,021 H525R probably damaging Het
Polq T G 16: 37,017,344 M206R probably damaging Het
Psap T A 10: 60,293,406 S100T probably benign Het
Psme4 G A 11: 30,772,364 probably benign Het
Serpina1d T A 12: 103,765,821 M260L probably benign Het
Serpinf2 A G 11: 75,437,404 L106P possibly damaging Het
Sumf1 C T 6: 108,118,463 probably benign Het
Tcp1 A G 17: 12,916,602 T13A probably benign Het
Tfap2a A C 13: 40,728,355 I185S possibly damaging Het
Tlr2 A C 3: 83,838,512 I88S probably damaging Het
Tmc4 A T 7: 3,672,023 F283L probably damaging Het
Tox4 T C 14: 52,285,820 V79A probably damaging Het
Trim10 A T 17: 36,870,181 E101D probably damaging Het
Troap T A 15: 99,075,419 I22N probably damaging Het
Unc13c C T 9: 73,533,903 probably null Het
Zeb2 T C 2: 44,996,919 M664V possibly damaging Het
Zfp180 A G 7: 24,101,484 Y53C possibly damaging Het
Other mutations in Utp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Utp4 APN 8 106894698 missense probably benign 0.02
IGL01871:Utp4 APN 8 106912317 missense probably benign
IGL02100:Utp4 APN 8 106898175 missense probably benign 0.00
IGL02501:Utp4 APN 8 106906241 missense probably benign 0.16
IGL02948:Utp4 APN 8 106894641 missense probably benign 0.31
IGL03210:Utp4 APN 8 106916256 missense probably benign
Cheyenne_canon UTSW 8 106912275 missense probably damaging 1.00
PIT4480001:Utp4 UTSW 8 106906185 missense probably benign 0.00
R0066:Utp4 UTSW 8 106922898 missense possibly damaging 0.70
R0066:Utp4 UTSW 8 106922898 missense possibly damaging 0.70
R0145:Utp4 UTSW 8 106894669 missense probably benign 0.02
R0158:Utp4 UTSW 8 106913386 missense probably null
R0360:Utp4 UTSW 8 106898537 unclassified probably benign
R0364:Utp4 UTSW 8 106898537 unclassified probably benign
R0382:Utp4 UTSW 8 106922935 missense probably benign 0.01
R0798:Utp4 UTSW 8 106922226 missense probably benign 0.00
R1164:Utp4 UTSW 8 106900844 critical splice acceptor site probably null
R1381:Utp4 UTSW 8 106906276 missense probably benign 0.02
R1440:Utp4 UTSW 8 106898053 unclassified probably benign
R1711:Utp4 UTSW 8 106918720 missense probably damaging 1.00
R1839:Utp4 UTSW 8 106913454 missense probably benign
R1903:Utp4 UTSW 8 106912350 critical splice donor site probably null
R2060:Utp4 UTSW 8 106898521 missense probably benign 0.33
R2938:Utp4 UTSW 8 106922929 missense probably damaging 1.00
R5526:Utp4 UTSW 8 106917633 missense possibly damaging 0.70
R5562:Utp4 UTSW 8 106922925 missense probably benign 0.00
R5814:Utp4 UTSW 8 106912275 missense probably damaging 1.00
R6310:Utp4 UTSW 8 106918621 missense probably benign 0.16
R6478:Utp4 UTSW 8 106904446 critical splice donor site probably null
R6523:Utp4 UTSW 8 106898463 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTATGAGGCCCTGACAAC -3'
(R):5'- AGTGGGTACTGCTTGCCAATG -3'

Sequencing Primer
(F):5'- GTATGAGGCCCTGACAACAACAAAAG -3'
(R):5'- CCAGGGAAGCCTCACTTAC -3'
Posted On2016-11-21