Mutagenetix > Incidental Mutation

Incidental Mutation 'R5799:Ncf4'

447420

Institutional Source

Beutler Lab

Gene Symbol

Ncf4

Ensembl Gene

ENSMUSG00000071715

Gene Name

neutrophil cytosolic factor 4

Synonyms

p40phox

MMRRC Submission

043388-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5799 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78129001-78146780 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78135177 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 78 (K78R)

Ref Sequence

ENSEMBL: ENSMUSP00000121191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096357] [ENSMUST00000133618]

AlphaFold

P97369

Predicted Effect

probably benign
Transcript: ENSMUST00000096357
AA Change: K78R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000094084
Gene: ENSMUSG00000071715
AA Change: K78R

Domain	Start	End	E-Value	Type
PX	18	136	3.16e-28	SMART
SH3	173	228	2.24e-19	SMART
PB1	237	329	8.06e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126028

Predicted Effect

probably benign
Transcript: ENSMUST00000133618
AA Change: K78R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121191
Gene: ENSMUSG00000071715
AA Change: K78R

Domain	Start	End	E-Value	Type
PX	18	136	3.16e-28	SMART
SH3	173	228	2.24e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146147

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147303

Meta Mutation Damage Score

0.1032

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

89% (51/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable but show impaired NADPH oxidase responses of neutrophils to a variety of stimuli and defective killing of S. aureus in vitro and in vivo. Homozygotes for a knock-in allele that prevents PtdIns3P binding to thePX domain fail in development prior to E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	C	T	1: 130,668,908 (GRCm39)	Q92*	probably null	Het
Accsl	T	C	2: 93,694,748 (GRCm39)		probably null	Het
Ahnak2	T	C	12: 112,745,365 (GRCm39)		probably benign	Het
Alcam	T	C	16: 52,130,212 (GRCm39)	D46G	probably benign	Het
Asap2	T	C	12: 21,218,247 (GRCm39)	S57P	probably damaging	Het
Atg14	A	T	14: 47,784,752 (GRCm39)	V314D	possibly damaging	Het
C230029F24Rik	C	T	1: 49,377,307 (GRCm39)		noncoding transcript	Het
Calcr	A	T	6: 3,707,592 (GRCm39)	I236N	probably benign	Het
Cass4	G	A	2: 172,258,107 (GRCm39)	G35E	probably damaging	Het
Chmp6	T	C	11: 119,807,517 (GRCm39)	I120T	probably benign	Het
Col13a1	A	G	10: 61,684,919 (GRCm39)		probably benign	Het
Cstdc4	T	A	16: 36,004,631 (GRCm39)	M1K	probably null	Het
Ddhd2	T	A	8: 26,238,629 (GRCm39)	L328F	probably damaging	Het
Defa40	T	A	8: 21,740,359 (GRCm39)		probably null	Het
Dnmt3l	A	G	10: 77,887,860 (GRCm39)	D123G	possibly damaging	Het
Eea1	T	A	10: 95,838,810 (GRCm39)	V287E	possibly damaging	Het
Efcc1	A	G	6: 87,708,164 (GRCm39)	N97S	probably benign	Het
Exd1	A	G	2: 119,369,262 (GRCm39)	S118P	probably benign	Het
Ext2	G	T	2: 93,642,317 (GRCm39)	T184K	probably benign	Het
Fam186a	G	A	15: 99,864,705 (GRCm39)	Q42*	probably null	Het
Gbp2	A	T	3: 142,337,843 (GRCm39)	I320L	probably benign	Het
Gramd2a	G	A	9: 59,615,299 (GRCm39)	G13R	probably benign	Het
H2-Q5	T	C	17: 35,613,115 (GRCm39)	M5T	unknown	Het
Jak3	C	T	8: 72,131,344 (GRCm39)	L70F	probably damaging	Het
Lhpp	G	A	7: 132,307,364 (GRCm39)	V254M	probably damaging	Het
Lig1	T	A	7: 13,030,184 (GRCm39)	V387E	possibly damaging	Het
Lipo3	T	C	19: 33,755,093 (GRCm39)		probably benign	Het
Lrrc8b	C	T	5: 105,629,208 (GRCm39)	S518L	probably benign	Het
Narf	T	C	11: 121,135,480 (GRCm39)	Y111H	probably damaging	Het
Nrap	A	T	19: 56,330,601 (GRCm39)	C1118*	probably null	Het
Nubp2	A	G	17: 25,104,772 (GRCm39)	V23A	probably damaging	Het
Or4l1	A	T	14: 50,166,497 (GRCm39)	F168Y	probably damaging	Het
Or6c219	A	T	10: 129,781,780 (GRCm39)	D50E	possibly damaging	Het
Or8g55	T	C	9: 39,785,392 (GRCm39)	S274P	possibly damaging	Het
Pdzd7	G	A	19: 45,025,428 (GRCm39)	P356S	probably benign	Het
Rttn	T	C	18: 89,056,070 (GRCm39)	V984A	probably damaging	Het
Ryr3	A	G	2: 112,516,925 (GRCm39)	S3334P	probably damaging	Het
Senp7	G	A	16: 55,959,468 (GRCm39)		probably null	Het
Slc25a3	A	C	10: 90,957,903 (GRCm39)	Y50D	probably benign	Het
Slc35e2	C	T	4: 155,694,483 (GRCm39)	P10L	probably benign	Het
Slc38a2	A	T	15: 96,592,970 (GRCm39)	S163T	probably benign	Het
Sp110	A	C	1: 85,505,050 (GRCm39)	F434C	probably benign	Het
Stam2	A	T	2: 52,610,922 (GRCm39)	C4*	probably null	Het
Taf1a	A	G	1: 183,177,272 (GRCm39)	D50G	possibly damaging	Het
Taf6l	A	T	19: 8,759,995 (GRCm39)	Y106N	possibly damaging	Het
Taf7l2	T	C	10: 115,948,674 (GRCm39)	E284G	probably damaging	Het
Tbx20	G	A	9: 24,636,816 (GRCm39)	Q424*	probably null	Het
Tex10	A	G	4: 48,433,295 (GRCm39)	V829A	possibly damaging	Het
Tgfbr3	T	C	5: 107,257,474 (GRCm39)		probably benign	Het
Tnfsf10	G	T	3: 27,389,742 (GRCm39)	V268F	probably damaging	Het
Trrap	A	G	5: 144,767,755 (GRCm39)	T2571A	probably benign	Het

Other mutations in Ncf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01935:Ncf4	APN	15	78,140,186 (GRCm39)	missense	probably damaging	1.00
IGL02546:Ncf4	APN	15	78,145,219 (GRCm39)	missense	probably damaging	1.00
IGL03064:Ncf4	APN	15	78,135,102 (GRCm39)	missense	probably damaging	1.00
IGL03407:Ncf4	APN	15	78,138,981 (GRCm39)	splice site	probably benign
R0281:Ncf4	UTSW	15	78,135,083 (GRCm39)	missense	probably damaging	0.96
R0378:Ncf4	UTSW	15	78,137,503 (GRCm39)	missense	probably damaging	0.98
R1513:Ncf4	UTSW	15	78,146,560 (GRCm39)	missense	probably benign
R1596:Ncf4	UTSW	15	78,134,637 (GRCm39)	missense	probably damaging	1.00
R1652:Ncf4	UTSW	15	78,145,234 (GRCm39)	missense	possibly damaging	0.83
R1815:Ncf4	UTSW	15	78,134,602 (GRCm39)	missense	probably benign	0.00
R1847:Ncf4	UTSW	15	78,134,582 (GRCm39)	missense	probably benign	0.33
R1927:Ncf4	UTSW	15	78,144,846 (GRCm39)	missense	probably damaging	1.00
R2984:Ncf4	UTSW	15	78,146,520 (GRCm39)	missense	probably benign	0.09
R4302:Ncf4	UTSW	15	78,144,962 (GRCm39)	unclassified	probably benign
R4649:Ncf4	UTSW	15	78,140,189 (GRCm39)	missense	possibly damaging	0.61
R4905:Ncf4	UTSW	15	78,139,104 (GRCm39)	missense	probably damaging	0.99
R5114:Ncf4	UTSW	15	78,146,593 (GRCm39)	unclassified	probably benign
R5531:Ncf4	UTSW	15	78,144,988 (GRCm39)	unclassified	probably benign
R7284:Ncf4	UTSW	15	78,144,902 (GRCm39)	missense	probably benign	0.01
R8193:Ncf4	UTSW	15	78,146,466 (GRCm39)	missense	probably damaging	1.00
R9447:Ncf4	UTSW	15	78,146,499 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGTGCTCATCTCCCAGTG -3'
(R):5'- GCAGTGAAGGTACCCTGAAG -3'

Sequencing Primer
(F):5'- TCAGCTCTCCTACCTTATAAAGAC -3'
(R):5'- TACCCTGAAGACAGAGGGGTG -3'

Posted On

2016-12-15