Incidental Mutation 'R5812:Olfr117'
ID447578
Institutional Source Beutler Lab
Gene Symbol Olfr117
Ensembl Gene ENSMUSG00000095286
Gene Nameolfactory receptor 117
SynonymsGA_x6K02T2PSCP-2119438-2118485, MOR256-33
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37657600-37663782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37659739 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 198 (L198P)
Ref Sequence ENSEMBL: ENSMUSP00000150204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073636] [ENSMUST00000213638] [ENSMUST00000215414]
Predicted Effect probably damaging
Transcript: ENSMUST00000073636
AA Change: L198P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073320
Gene: ENSMUSG00000095286
AA Change: L198P

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 222 2e-5 PFAM
Pfam:7tm_1 40 289 2.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213638
AA Change: L198P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215414
AA Change: L198P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Olfr117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr117 APN 17 37659477 missense probably damaging 1.00
IGL01949:Olfr117 APN 17 37659466 missense probably damaging 1.00
IGL02085:Olfr117 APN 17 37659688 missense probably benign 0.11
IGL02481:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL02483:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL03274:Olfr117 APN 17 37659755 missense probably benign 0.35
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R1522:Olfr117 UTSW 17 37659770 missense probably damaging 1.00
R1712:Olfr117 UTSW 17 37659908 missense probably benign 0.42
R1750:Olfr117 UTSW 17 37659673 missense probably damaging 1.00
R1865:Olfr117 UTSW 17 37659863 missense possibly damaging 0.78
R2371:Olfr117 UTSW 17 37660153 missense probably damaging 1.00
R2382:Olfr117 UTSW 17 37659931 missense probably benign 0.00
R3798:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R4831:Olfr117 UTSW 17 37660078 missense probably benign 0.03
R5087:Olfr117 UTSW 17 37659721 missense probably damaging 0.97
R5365:Olfr117 UTSW 17 37659695 missense probably damaging 1.00
R5822:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R6405:Olfr117 UTSW 17 37660123 missense possibly damaging 0.58
R6945:Olfr117 UTSW 17 37659514 missense possibly damaging 0.95
R7121:Olfr117 UTSW 17 37659808 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGTGCTTGTGCCATAAAATAG -3'
(R):5'- CTATGCTGCTGTTTGCCGAC -3'

Sequencing Primer
(F):5'- GTGCTTGTGCCATAAAATAGTACTAC -3'
(R):5'- TATGCTACAGTTATGCACCCACGG -3'
Posted On2016-12-15