Incidental Mutation 'R2371:Olfr117'
ID247542
Institutional Source Beutler Lab
Gene Symbol Olfr117
Ensembl Gene ENSMUSG00000095286
Gene Nameolfactory receptor 117
SynonymsGA_x6K02T2PSCP-2119438-2118485, MOR256-33
MMRRC Submission 040351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2371 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37657600-37663782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37660153 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000150204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073636] [ENSMUST00000213638] [ENSMUST00000215414]
Predicted Effect probably damaging
Transcript: ENSMUST00000073636
AA Change: Y60C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073320
Gene: ENSMUSG00000095286
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 222 2e-5 PFAM
Pfam:7tm_1 40 289 2.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213638
AA Change: Y60C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215414
AA Change: Y60C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Adamts18 T A 8: 113,705,261 E1105V probably benign Het
Colec10 A G 15: 54,462,400 I209V possibly damaging Het
Cttnbp2 T G 6: 18,380,604 S1422R possibly damaging Het
Dcst1 C G 3: 89,358,642 V179L possibly damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fgl2 A T 5: 21,375,818 Y386F probably damaging Het
Gabrb2 A G 11: 42,591,864 Y183C probably damaging Het
Hlcs A G 16: 94,268,067 L245P probably damaging Het
Hormad1 T A 3: 95,575,599 I132K probably benign Het
Itga8 A T 2: 12,253,466 D262E probably damaging Het
Jhy G A 9: 40,917,482 T376I probably benign Het
Kidins220 T C 12: 25,057,324 L1592P probably damaging Het
Kif3b T C 2: 153,322,823 I587T possibly damaging Het
Lrrc7 A G 3: 158,161,060 Y1015H probably damaging Het
Lvrn T G 18: 46,878,163 probably null Het
Mapkbp1 C A 2: 120,010,780 Q83K probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Pigc T C 1: 161,971,010 V187A possibly damaging Het
Ros1 A T 10: 52,163,895 H333Q possibly damaging Het
Rreb1 T C 13: 37,916,537 F215L probably benign Het
Rtcb C T 10: 85,943,833 M324I probably benign Het
Senp2 A G 16: 22,018,375 I125V possibly damaging Het
Shroom3 A G 5: 92,780,870 K95E probably damaging Het
Wrnip1 C T 13: 32,802,427 P64S probably benign Het
Zbtb24 C T 10: 41,451,268 A50V probably damaging Het
Other mutations in Olfr117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr117 APN 17 37659477 missense probably damaging 1.00
IGL01949:Olfr117 APN 17 37659466 missense probably damaging 1.00
IGL02085:Olfr117 APN 17 37659688 missense probably benign 0.11
IGL02481:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL02483:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL03274:Olfr117 APN 17 37659755 missense probably benign 0.35
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R1522:Olfr117 UTSW 17 37659770 missense probably damaging 1.00
R1712:Olfr117 UTSW 17 37659908 missense probably benign 0.42
R1750:Olfr117 UTSW 17 37659673 missense probably damaging 1.00
R1865:Olfr117 UTSW 17 37659863 missense possibly damaging 0.78
R2382:Olfr117 UTSW 17 37659931 missense probably benign 0.00
R3798:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R4831:Olfr117 UTSW 17 37660078 missense probably benign 0.03
R5087:Olfr117 UTSW 17 37659721 missense probably damaging 0.97
R5365:Olfr117 UTSW 17 37659695 missense probably damaging 1.00
R5812:Olfr117 UTSW 17 37659739 missense probably damaging 1.00
R5822:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R6405:Olfr117 UTSW 17 37660123 missense possibly damaging 0.58
R6945:Olfr117 UTSW 17 37659514 missense possibly damaging 0.95
R7121:Olfr117 UTSW 17 37659808 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGGTGCATAACTGTAGCATAG -3'
(R):5'- TAACAAGAGCTCGGGTGGTG -3'

Sequencing Primer
(F):5'- TAGCGGTCAAATGCCATAACTG -3'
(R):5'- ACAAGAGCTCGGGTGGTGATTTC -3'
Posted On2014-11-11