Incidental Mutation 'R5819:Mov10'
ID449208
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene NameMoloney leukemia virus 10
SynonymsMov-10
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location104794836-104818563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104801512 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 395 (G395D)
Ref Sequence ENSEMBL: ENSMUSP00000128246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000136148] [ENSMUST00000166979] [ENSMUST00000168015]
Predicted Effect probably damaging
Transcript: ENSMUST00000002297
AA Change: G395D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227
AA Change: G395D

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106775
AA Change: G468D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: G468D

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145414
Predicted Effect probably damaging
Transcript: ENSMUST00000166979
AA Change: G468D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: G468D

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168015
AA Change: G395D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227
AA Change: G395D

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104800947 splice site probably benign
IGL01111:Mov10 APN 3 104801405 missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104795945 missense probably damaging 0.98
IGL01463:Mov10 APN 3 104800324 missense probably damaging 1.00
IGL02114:Mov10 APN 3 104795318 unclassified probably benign
IGL02354:Mov10 APN 3 104804121 splice site probably benign
IGL02361:Mov10 APN 3 104804121 splice site probably benign
IGL02692:Mov10 APN 3 104800803 nonsense probably null
IGL03104:Mov10 APN 3 104797307 missense probably damaging 1.00
IGL03121:Mov10 APN 3 104801002 missense probably benign
P0040:Mov10 UTSW 3 104804679 missense probably damaging 1.00
R0025:Mov10 UTSW 3 104804603 missense probably damaging 1.00
R0270:Mov10 UTSW 3 104795405 missense probably benign 0.09
R0747:Mov10 UTSW 3 104802496 missense probably benign 0.41
R1434:Mov10 UTSW 3 104795174 missense probably damaging 1.00
R1482:Mov10 UTSW 3 104804546 missense probably damaging 0.98
R1594:Mov10 UTSW 3 104795411 missense probably damaging 1.00
R1656:Mov10 UTSW 3 104799596 missense probably benign 0.03
R1739:Mov10 UTSW 3 104800282 missense probably damaging 0.98
R1785:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1786:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104801560 splice site probably benign
R1962:Mov10 UTSW 3 104796977 missense probably damaging 1.00
R1993:Mov10 UTSW 3 104799419 missense probably damaging 1.00
R2095:Mov10 UTSW 3 104801531 missense probably damaging 1.00
R2138:Mov10 UTSW 3 104804242 missense probably benign 0.00
R3107:Mov10 UTSW 3 104799724 missense probably damaging 1.00
R4241:Mov10 UTSW 3 104797276 missense probably benign 0.45
R4280:Mov10 UTSW 3 104799779 missense probably damaging 0.98
R4474:Mov10 UTSW 3 104818465 missense probably damaging 1.00
R5227:Mov10 UTSW 3 104802578 missense probably benign
R5391:Mov10 UTSW 3 104802533 missense probably benign 0.12
R5704:Mov10 UTSW 3 104799596 missense probably benign 0.03
R5842:Mov10 UTSW 3 104799379 splice site probably benign
R6059:Mov10 UTSW 3 104817950 utr 3 prime probably benign
R6692:Mov10 UTSW 3 104818044 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCTGAAAGCAAGACCTCCTATG -3'
(R):5'- ACTGGCCAAGAAGCAGCTAG -3'

Sequencing Primer
(F):5'- AAGACCTCCTATGCCCAGGG -3'
(R):5'- TGGGGACATTGGCACCACTG -3'
Posted On2016-12-20