Incidental Mutation 'R5880:Il15ra'
ID454366
Institutional Source Beutler Lab
Gene Symbol Il15ra
Ensembl Gene ENSMUSG00000023206
Gene Nameinterleukin 15 receptor, alpha chain
Synonyms
MMRRC Submission 043235-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5880 (G1)
Quality Score82
Status Not validated
Chromosome2
Chromosomal Location11705290-11734317 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 11730615 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 104 (*104W)
Ref Sequence ENSEMBL: ENSMUSP00000132058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078834] [ENSMUST00000114831] [ENSMUST00000114832] [ENSMUST00000114833] [ENSMUST00000114834] [ENSMUST00000123600] [ENSMUST00000128156] [ENSMUST00000135341] [ENSMUST00000138349] [ENSMUST00000148748]
Predicted Effect probably benign
Transcript: ENSMUST00000078834
AA Change: M221V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206
AA Change: M221V

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091456
Predicted Effect probably benign
Transcript: ENSMUST00000114831
AA Change: M188V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206
AA Change: M188V

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114832
AA Change: M113V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206
AA Change: M113V

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114833
AA Change: M124V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206
AA Change: M124V

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114834
AA Change: M155V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206
AA Change: M155V

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123600
AA Change: *156W
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206
AA Change: *156W

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126394
SMART Domains Protein: ENSMUSP00000131640
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128156
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126364
Gene: ENSMUSG00000023206
AA Change: M81V

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135341
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206
AA Change: M81V

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138349
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131473
Gene: ENSMUSG00000023206
AA Change: M81V

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139774
Predicted Effect probably null
Transcript: ENSMUST00000148748
AA Change: *104W
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206
AA Change: *104W

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191662
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 93.4%
  • 20x: 74.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mutation of this gene results in absence of NK cell production in spleen and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G A 18: 74,804,001 V319M probably damaging Het
Actrt2 T A 4: 154,667,290 T130S probably benign Het
Ap1g2 A G 14: 55,102,700 S392P probably damaging Het
Cdh23 T A 10: 60,384,934 N1344Y probably damaging Het
Cyp4x1 A T 4: 115,108,721 H469Q possibly damaging Het
Dhodh T A 8: 109,594,777 T326S probably benign Het
Ebf3 T G 7: 137,198,638 N529T probably benign Het
Echdc2 A C 4: 108,172,900 I133L possibly damaging Het
Fbn2 A T 18: 58,023,282 C2488* probably null Het
Fndc3b T A 3: 27,428,903 T1049S probably damaging Het
Igsf10 T C 3: 59,330,831 Y643C probably damaging Het
Iqgap3 T A 3: 88,117,202 S628R possibly damaging Het
Lrp1b C T 2: 41,341,814 V1215M probably benign Het
Mmp20 G A 9: 7,655,001 R370Q probably benign Het
Olfr120 T C 17: 37,726,654 V219A probably benign Het
Olfr731 A G 14: 50,238,715 S57P possibly damaging Het
Olfr984 A T 9: 40,101,247 M81K possibly damaging Het
Patj A T 4: 98,411,145 H168L probably damaging Het
Peak1 A T 9: 56,207,610 I319N probably damaging Het
Rgs20 A T 1: 4,923,881 C93S probably damaging Het
Sh3tc2 A T 18: 61,973,311 H137L probably benign Het
Spert C T 14: 75,583,803 V119I probably benign Het
Sycp2 A G 2: 178,374,470 V733A possibly damaging Het
Tet3 G C 6: 83,370,550 P1154R probably damaging Het
Other mutations in Il15ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Il15ra APN 2 11733145 splice site probably benign
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0945:Il15ra UTSW 2 11718327 missense probably damaging 0.96
R1863:Il15ra UTSW 2 11723436 missense possibly damaging 0.85
R1975:Il15ra UTSW 2 11723523 missense possibly damaging 0.94
R2172:Il15ra UTSW 2 11723571 missense possibly damaging 0.94
R2202:Il15ra UTSW 2 11718344 critical splice donor site probably null
R3709:Il15ra UTSW 2 11730647 critical splice donor site probably null
R3710:Il15ra UTSW 2 11730647 critical splice donor site probably null
R4621:Il15ra UTSW 2 11718329 missense possibly damaging 0.95
R4701:Il15ra UTSW 2 11718345 splice site probably null
R4779:Il15ra UTSW 2 11718306 missense probably damaging 0.98
R4844:Il15ra UTSW 2 11718271 start gained probably benign
R5237:Il15ra UTSW 2 11733205 missense possibly damaging 0.91
R5810:Il15ra UTSW 2 11733252 unclassified probably null
R6160:Il15ra UTSW 2 11720016 missense probably damaging 0.99
R7291:Il15ra UTSW 2 11718381 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGGCTAGAAGAACATCC -3'
(R):5'- TCAGTGCCTGCTGACATGTG -3'

Sequencing Primer
(F):5'- TGGCTAGAAGAACATCCGTCCTG -3'
(R):5'- CCTGTGTGAGAAGTGGATAGCC -3'
Posted On2017-02-10