Incidental Mutation 'R5894:Musk'
ID457364
Institutional Source Beutler Lab
Gene Symbol Musk
Ensembl Gene ENSMUSG00000057280
Gene Namemuscle, skeletal, receptor tyrosine kinase
SynonymsMDK4, Nsk1, Nsk2, Nsk3
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5894 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58285960-58374303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58373583 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 836 (C836Y)
Ref Sequence ENSEMBL: ENSMUSP00000137453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]
Predicted Effect probably damaging
Transcript: ENSMUST00000081919
AA Change: C826Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: C826Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084578
AA Change: C826Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: C826Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.2e-28 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098057
AA Change: C851Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: C851Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 342 467 1.4e-15 PFAM
transmembrane domain 520 542 N/A INTRINSIC
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 592 N/A INTRINSIC
TyrKc 599 880 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098059
AA Change: C828Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: C828Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 2.1e-28 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102893
AA Change: C818Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: C818Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 487 509 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
TyrKc 566 847 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177951
AA Change: C828Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: C828Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 327 458 1.1e-27 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179951
AA Change: C836Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: C836Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 1.2e-27 PFAM
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
TyrKc 584 865 2.96e-140 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Musk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Musk APN 4 58367539 missense probably damaging 1.00
IGL01727:Musk APN 4 58303887 missense probably benign 0.37
IGL01981:Musk APN 4 58296629 missense probably damaging 1.00
IGL02064:Musk APN 4 58286128 missense possibly damaging 0.89
IGL02326:Musk APN 4 58354113 missense probably benign 0.02
IGL02475:Musk APN 4 58353936 critical splice acceptor site probably benign
IGL02585:Musk APN 4 58347849 missense probably benign
IGL02719:Musk APN 4 58356496 missense probably benign
IGL02797:Musk APN 4 58366921 missense probably benign 0.00
IGL02869:Musk APN 4 58354078 missense probably benign 0.05
IGL02940:Musk APN 4 58373364 missense probably damaging 1.00
IGL03167:Musk APN 4 58366821 missense possibly damaging 0.81
IGL03230:Musk APN 4 58296710 missense probably damaging 1.00
R0384:Musk UTSW 4 58373711 makesense probably null
R1014:Musk UTSW 4 58354156 missense possibly damaging 0.88
R1462:Musk UTSW 4 58286204 splice site probably benign
R1493:Musk UTSW 4 58354003 missense probably benign 0.19
R1739:Musk UTSW 4 58293563 missense probably damaging 1.00
R1883:Musk UTSW 4 58373189 missense probably benign 0.18
R2230:Musk UTSW 4 58333672 missense possibly damaging 0.79
R2914:Musk UTSW 4 58366938 missense probably damaging 0.99
R3508:Musk UTSW 4 58327347 missense probably damaging 0.98
R4225:Musk UTSW 4 58373240 missense probably damaging 0.99
R4601:Musk UTSW 4 58301625 missense probably damaging 0.99
R4771:Musk UTSW 4 58301706 missense probably benign 0.16
R4793:Musk UTSW 4 58373400 missense probably damaging 1.00
R4845:Musk UTSW 4 58296679 missense probably damaging 1.00
R4919:Musk UTSW 4 58366899 missense probably damaging 1.00
R4954:Musk UTSW 4 58344222 missense probably damaging 0.96
R5596:Musk UTSW 4 58373036 missense probably damaging 1.00
R5715:Musk UTSW 4 58333663 missense probably damaging 1.00
R5934:Musk UTSW 4 58373613 missense probably damaging 1.00
R6230:Musk UTSW 4 58367576 missense probably damaging 1.00
R6335:Musk UTSW 4 58366811 missense probably benign
R6358:Musk UTSW 4 58373171 missense possibly damaging 0.72
R6395:Musk UTSW 4 58286169 missense probably benign
R6652:Musk UTSW 4 58368977 missense probably damaging 1.00
R6764:Musk UTSW 4 58354027 missense probably damaging 1.00
R7233:Musk UTSW 4 58373307 missense possibly damaging 0.83
R7238:Musk UTSW 4 58344312 missense probably benign 0.01
R7271:Musk UTSW 4 58373409 missense probably damaging 1.00
X0020:Musk UTSW 4 58368996 missense probably damaging 1.00
X0066:Musk UTSW 4 58327356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGCAGACTACTACAAAGCTGATG -3'
(R):5'- CAGTCTGAAAAGAGCCTCCTG -3'

Sequencing Primer
(F):5'- TGGAAATGACGCCATCCCTATC -3'
(R):5'- AAAAGAGCCTCCTGGGTGTTG -3'
Posted On2017-02-15