Incidental Mutation 'R0517:Adcyap1r1'
ID48225
Institutional Source Beutler Lab
Gene Symbol Adcyap1r1
Ensembl Gene ENSMUSG00000029778
Gene Nameadenylate cyclase activating polypeptide 1 receptor 1
SynonymsPAC1R, PAC1, PACAP1-R, 2900024I10Rik
MMRRC Submission 038710-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R0517 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55451978-55501451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55491297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 373 (S373T)
Ref Sequence ENSEMBL: ENSMUSP00000063784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070736] [ENSMUST00000070756] [ENSMUST00000165786] [ENSMUST00000165857] [ENSMUST00000167234] [ENSMUST00000172084]
Predicted Effect probably damaging
Transcript: ENSMUST00000070736
AA Change: S373T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063784
Gene: ENSMUSG00000029778
AA Change: S373T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 3.6e-92 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070756
SMART Domains Protein: ENSMUSP00000066902
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 396 2.6e-93 PFAM
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165786
AA Change: S372T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130923
Gene: ENSMUSG00000029778
AA Change: S372T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 423 2.6e-92 PFAM
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165857
SMART Domains Protein: ENSMUSP00000129614
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 1.4e-94 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167234
AA Change: S401T

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126994
Gene: ENSMUSG00000029778
AA Change: S401T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 452 1.4e-91 PFAM
low complexity region 502 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172084
SMART Domains Protein: ENSMUSP00000127319
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 122 2.15e-27 SMART
Pfam:7tm_2 129 375 9e-94 PFAM
low complexity region 425 440 N/A INTRINSIC
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted mutations affect contextual fear conditioning, elevated locomotor activity, anxiety-like behavior, susceptibility to endotoxic shock, circadian responses to a photic stimulus, and glucose tolerance. Some alleles affect female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,981,132 probably benign Het
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Cacna1d A T 14: 30,179,275 I274K probably damaging Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fam208b T A 13: 3,566,964 T2367S possibly damaging Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Pros1 A G 16: 62,903,518 S210G probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Setx T G 2: 29,157,133 S1874R probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Vmn2r120 T C 17: 57,508,949 Y802C probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in Adcyap1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Adcyap1r1 APN 6 55472279 missense probably damaging 1.00
IGL00837:Adcyap1r1 APN 6 55461620 splice site probably benign
IGL02686:Adcyap1r1 APN 6 55481125 missense probably benign 0.37
IGL03229:Adcyap1r1 APN 6 55478123 missense probably damaging 1.00
PIT4458001:Adcyap1r1 UTSW 6 55478082 missense probably benign 0.00
R0360:Adcyap1r1 UTSW 6 55475523 intron probably benign
R1169:Adcyap1r1 UTSW 6 55494116 missense probably damaging 1.00
R1897:Adcyap1r1 UTSW 6 55479194 missense probably damaging 1.00
R2113:Adcyap1r1 UTSW 6 55481115 missense probably damaging 0.99
R4462:Adcyap1r1 UTSW 6 55480099 missense possibly damaging 0.90
R4871:Adcyap1r1 UTSW 6 55480093 missense probably null 0.34
R5146:Adcyap1r1 UTSW 6 55484972 missense probably benign 0.00
R5341:Adcyap1r1 UTSW 6 55478069 missense probably benign 0.00
R6426:Adcyap1r1 UTSW 6 55494187 missense probably damaging 1.00
R6599:Adcyap1r1 UTSW 6 55479994 missense probably damaging 1.00
R6928:Adcyap1r1 UTSW 6 55479272 missense possibly damaging 0.92
R7059:Adcyap1r1 UTSW 6 55491310 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCCTGTGAATTGAGTCTTGCC -3'
(R):5'- AGTAGCAGCCAGGTCAAGATGTCC -3'

Sequencing Primer
(F):5'- GAATTGAGTCTTGCCAAGTCC -3'
(R):5'- GTCAAGATGTCCCTGCGAG -3'
Posted On2013-06-12