Incidental Mutation 'R6043:Kitl'
ID483674
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Namekit ligand
SynonymsGb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
MMRRC Submission 044211-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6043 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location100015630-100100416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100064085 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 84 (V84E)
Ref Sequence ENSEMBL: ENSMUSP00000123360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
Predicted Effect probably damaging
Transcript: ENSMUST00000020129
AA Change: V44E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: V44E

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105283
AA Change: V44E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: V44E

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130190
AA Change: V84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966
AA Change: V84E

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 T C 1: 171,252,601 F44S probably damaging Het
Ap3b1 A T 13: 94,476,993 T667S probably benign Het
BC027072 T C 17: 71,750,042 D880G probably damaging Het
Camsap1 T C 2: 25,929,925 Y1516C probably benign Het
Ccl17 A G 8: 94,810,472 M1V probably null Het
Cfhr1 T A 1: 139,550,868 T255S probably benign Het
Clcn6 T C 4: 148,008,788 N812D probably damaging Het
Cyp2b10 T C 7: 25,917,339 F402L probably damaging Het
Dgkz A C 2: 91,935,889 S776A probably benign Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dnah10 G A 5: 124,801,860 G2728S probably damaging Het
Dnah7b T A 1: 46,139,789 M874K probably benign Het
Eef1akmt3 A T 10: 127,033,278 L109Q probably damaging Het
Egf A G 3: 129,736,785 S243P probably benign Het
Fbxw21 T C 9: 109,145,539 I304M possibly damaging Het
Fcgr4 T C 1: 171,020,130 V99A probably damaging Het
Fhdc1 T C 3: 84,448,886 E417G probably damaging Het
Flnc G T 6: 29,446,608 G939V probably damaging Het
Herc1 A G 9: 66,408,154 M1173V probably benign Het
Hspa2 C T 12: 76,406,322 H597Y probably damaging Het
Itgb4 C T 11: 115,979,386 T64I probably benign Het
Kif16b A G 2: 142,711,900 S993P probably damaging Het
Klra17 A G 6: 129,872,187 probably null Het
Map2k3 A G 11: 60,946,746 D224G probably benign Het
Medag T G 5: 149,422,207 F4V probably benign Het
Mob3b C T 4: 34,985,993 V182I probably benign Het
Mvb12b G T 2: 33,874,390 T49K probably damaging Het
Naaladl2 A G 3: 24,058,214 V568A possibly damaging Het
Nbea T C 3: 55,786,475 E2174G probably benign Het
Nmd3 T C 3: 69,745,247 Y389H probably benign Het
Olfr1180 C T 2: 88,412,245 E138K probably benign Het
Olfr309 A G 7: 86,306,339 I258T probably damaging Het
Pcdh1 T A 18: 38,203,274 N103Y probably damaging Het
Pcm1 A G 8: 41,328,778 D1905G possibly damaging Het
Plcd1 A G 9: 119,072,599 F619S probably damaging Het
Ptdss1 T A 13: 66,963,369 D166E probably damaging Het
Rnf213 T C 11: 119,442,101 V2713A probably damaging Het
Sema4f T C 6: 82,919,653 N200D probably damaging Het
Tjp1 A T 7: 65,324,089 N472K probably damaging Het
Trav6n-5 T C 14: 53,105,151 Y49H probably benign Het
Trbv2 A G 6: 41,047,970 T107A probably benign Het
Unc13c T C 9: 73,736,651 N1177S possibly damaging Het
Vmn1r212 A G 13: 22,884,088 V25A probably damaging Het
Zfhx4 T G 3: 5,403,427 S2882A probably benign Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
gregory UTSW 10 100076906 critical splice donor site probably null
mooyah UTSW 10 100088222 critical splice donor site probably null
sandycheeks UTSW 10 100076906 critical splice donor site probably null
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
R7315:Kitl UTSW 10 100016112 missense unknown
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGGAATTCCAGTGTTACAG -3'
(R):5'- TGCTCATTGATAATCTTAGCAGCAG -3'

Sequencing Primer
(F):5'- ATGACTTCACTAGCCCTGGGTG -3'
(R):5'- GCAGCAGCTTGAGGGGG -3'
Posted On2017-07-14