Incidental Mutation 'R6117:Sox15'
ID485172
Institutional Source Beutler Lab
Gene Symbol Sox15
Ensembl Gene ENSMUSG00000041287
Gene NameSRY (sex determining region Y)-box 15
Synonyms
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69655314-69656727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69655890 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 173 (G173V)
Ref Sequence ENSEMBL: ENSMUSP00000048524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018905] [ENSMUST00000018909] [ENSMUST00000047373] [ENSMUST00000148242] [ENSMUST00000155200]
Predicted Effect probably benign
Transcript: ENSMUST00000018905
SMART Domains Protein: ENSMUSP00000018905
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 141 157 N/A INTRINSIC
CTNS 167 198 5.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018909
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047373
AA Change: G173V

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048524
Gene: ENSMUSG00000041287
AA Change: G173V

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
HMG 46 116 6.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125389
SMART Domains Protein: ENSMUSP00000129025
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
CTNS 39 70 1.69e-6 SMART
low complexity region 89 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127118
Predicted Effect probably benign
Transcript: ENSMUST00000129224
SMART Domains Protein: ENSMUSP00000120001
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
CTNS 54 85 1.69e-6 SMART
low complexity region 138 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139155
Predicted Effect probably benign
Transcript: ENSMUST00000148242
SMART Domains Protein: ENSMUSP00000133074
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 98 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153217
Predicted Effect probably benign
Transcript: ENSMUST00000155200
SMART Domains Protein: ENSMUSP00000117715
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscle fiber differentiation and in muscle regeneration after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Sox15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1247:Sox15 UTSW 11 69656494 missense probably benign 0.33
R1340:Sox15 UTSW 11 69655547 missense probably damaging 1.00
R5174:Sox15 UTSW 11 69655719 missense probably damaging 1.00
R5938:Sox15 UTSW 11 69655730 missense probably damaging 1.00
R5958:Sox15 UTSW 11 69655730 missense probably damaging 1.00
R5959:Sox15 UTSW 11 69655730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGATCTCCAAGCGCTTG -3'
(R):5'- CACTATCCTGAACTCTGGGC -3'

Sequencing Primer
(F):5'- AGGCTAAGCGTCTTCGTGC -3'
(R):5'- TGAACTCTGGGCCCTCAG -3'
Posted On2017-08-16