Incidental Mutation 'R6117:Olfr811'
ID485169
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129801820 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 235 (A235V)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably damaging
Transcript: ENSMUST00000076437
AA Change: A235V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: A235V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215058
AA Change: A235V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably damaging
Transcript: ENSMUST00000217571
AA Change: A235V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTTCCTTCACCTGCTG -3'
(R):5'- TTTTGTGCCTCCAAAACAATAGACC -3'

Sequencing Primer
(F):5'- CACCTGCTGATTCCTTAGGGTG -3'
(R):5'- ATAGACCACTTCCTGTGTGACAG -3'
Posted On2017-08-16