Incidental Mutation 'R6183:Sptbn5'
ID487608
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Namespectrin beta, non-erythrocytic 5
SynonymsEG640524, Spnb5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6183 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120046157-120085772 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 120059417 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110756]
Predicted Effect probably benign
Transcript: ENSMUST00000110756
SMART Domains Protein: ENSMUSP00000106384
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 13 111 6.45e-8 SMART
Blast:SPEC 117 206 9e-12 BLAST
SPEC 219 323 3.76e-1 SMART
SPEC 325 425 3.48e-13 SMART
SPEC 431 530 1.09e-5 SMART
SPEC 536 631 1.22e-1 SMART
SPEC 637 737 1.78e-10 SMART
SPEC 743 837 4.73e-15 SMART
SPEC 843 944 4.24e-17 SMART
SPEC 950 1051 1.36e-15 SMART
Blast:SPEC 1057 1130 2e-40 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000115497
Gene: ENSMUSG00000074899
AA Change: R235K

DomainStartEndE-ValueType
Blast:SPEC 2 28 6e-8 BLAST
SPEC 34 128 2.43e-3 SMART
SPEC 134 234 9.38e-19 SMART
Blast:SPEC 240 280 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 120054467 unclassified probably benign
IGL01552:Sptbn5 APN 2 120054422 unclassified probably benign
IGL01800:Sptbn5 APN 2 120056427 unclassified probably benign
IGL02156:Sptbn5 APN 2 120047617 unclassified probably benign
R0020:Sptbn5 UTSW 2 120065631 missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 120062675 unclassified probably null
R1121:Sptbn5 UTSW 2 120069390 unclassified probably null
R1223:Sptbn5 UTSW 2 120072044 missense probably damaging 0.99
R1405:Sptbn5 UTSW 2 120050616 splice site noncoding transcript
R1852:Sptbn5 UTSW 2 120071644 missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 120070462 missense probably benign 0.00
R2570:Sptbn5 UTSW 2 120048640 exon noncoding transcript
R3898:Sptbn5 UTSW 2 120057210 exon noncoding transcript
R3976:Sptbn5 UTSW 2 120048261 splice site noncoding transcript
R4092:Sptbn5 UTSW 2 120067051 missense probably damaging 0.99
R4119:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4120:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4352:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4364:Sptbn5 UTSW 2 120068655 missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 120065994 missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 120067446 unclassified probably null
R4616:Sptbn5 UTSW 2 120048757 exon noncoding transcript
R4687:Sptbn5 UTSW 2 120077208 unclassified probably benign
R4693:Sptbn5 UTSW 2 120059416 unclassified probably benign
R4762:Sptbn5 UTSW 2 120077222 unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 120059141 unclassified probably benign
R4818:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4822:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4825:Sptbn5 UTSW 2 120055893 unclassified probably benign
R4933:Sptbn5 UTSW 2 120050120 exon noncoding transcript
R4970:Sptbn5 UTSW 2 120051777 exon noncoding transcript
R5141:Sptbn5 UTSW 2 120061731 missense probably benign 0.03
R5209:Sptbn5 UTSW 2 120072002 missense probably benign 0.09
R5225:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5227:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5421:Sptbn5 UTSW 2 120080780 critical splice donor site noncoding transcript
R5495:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5498:Sptbn5 UTSW 2 120076638 unclassified probably benign
R5511:Sptbn5 UTSW 2 120059721 unclassified probably benign
R5596:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5616:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5617:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5619:Sptbn5 UTSW 2 120050132 exon noncoding transcript
R5625:Sptbn5 UTSW 2 120079792 exon noncoding transcript
R5636:Sptbn5 UTSW 2 120057404 unclassified probably benign
R5646:Sptbn5 UTSW 2 120048811 splice site noncoding transcript
R5666:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5670:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5715:Sptbn5 UTSW 2 120072504 missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 120050458 exon noncoding transcript
R5885:Sptbn5 UTSW 2 120076663 unclassified probably benign
R6016:Sptbn5 UTSW 2 120050092 exon noncoding transcript
R6184:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6219:Sptbn5 UTSW 2 120077322 unclassified probably benign
R6335:Sptbn5 UTSW 2 120054419 unclassified probably benign
R6383:Sptbn5 UTSW 2 120046269 unclassified probably benign
R6450:Sptbn5 UTSW 2 120047135 unclassified probably benign
R6516:Sptbn5 UTSW 2 120047950 unclassified probably benign
R6523:Sptbn5 UTSW 2 120065614 unclassified probably null
R6657:Sptbn5 UTSW 2 120076400 unclassified probably benign
R6661:Sptbn5 UTSW 2 120072375 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TAAGGAAACATGGATGCTTGCG -3'
(R):5'- ACTCCAAAGCACTGATGGTTG -3'

Sequencing Primer
(F):5'- GAAACATGGATGCTTGCGATCTCC -3'
(R):5'- CCAAAGCACTGATGGTTGAGGTAAG -3'
Posted On2017-10-10