Incidental Mutation 'R4674:Ssb'
ID500718
Institutional Source Beutler Lab
Gene Symbol Ssb
Ensembl Gene ENSMUSG00000068882
Gene NameSjogren syndrome antigen B
SynonymsSS-B, autoantigen La, La protein
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69861562-69871846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69868850 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 209 (Q209R)
Ref Sequence ENSEMBL: ENSMUSP00000130313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000090852] [ENSMUST00000112260] [ENSMUST00000132186] [ENSMUST00000142127] [ENSMUST00000166411]
Predicted Effect probably benign
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090852
AA Change: Q209R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088365
Gene: ENSMUSG00000068882
AA Change: Q209R

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 2.2e-32 PFAM
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112260
SMART Domains Protein: ENSMUSP00000107879
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132186
SMART Domains Protein: ENSMUSP00000119773
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
Pfam:RRM_1 113 154 2.6e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132603
AA Change: Q24R
SMART Domains Protein: ENSMUSP00000115666
Gene: ENSMUSG00000068882
AA Change: Q24R

DomainStartEndE-ValueType
Pfam:RRM_3 46 149 2.5e-33 PFAM
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135459
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156057
Predicted Effect probably benign
Transcript: ENSMUST00000166411
AA Change: Q209R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130313
Gene: ENSMUSG00000068882
AA Change: Q209R

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 1.9e-35 PFAM
low complexity region 375 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos, possible before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Ssb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ssb APN 2 69866262 missense probably benign 0.06
IGL00940:Ssb APN 2 69870835 critical splice donor site probably null
IGL00941:Ssb APN 2 69870835 critical splice donor site probably null
IGL01834:Ssb APN 2 69870803 missense possibly damaging 0.89
R0713:Ssb UTSW 2 69867359 missense probably benign 0.06
R0716:Ssb UTSW 2 69867359 missense probably benign 0.06
R0751:Ssb UTSW 2 69870565 missense probably benign
R1139:Ssb UTSW 2 69866576 missense possibly damaging 0.66
R1928:Ssb UTSW 2 69867557 splice site probably null
R2037:Ssb UTSW 2 69868819 missense probably benign 0.16
R3968:Ssb UTSW 2 69867449 splice site probably benign
R5039:Ssb UTSW 2 69866237 missense possibly damaging 0.79
R5551:Ssb UTSW 2 69871130 missense probably damaging 0.99
R6102:Ssb UTSW 2 69871208 makesense probably null
R7126:Ssb UTSW 2 69866501 missense possibly damaging 0.70
R7448:Ssb UTSW 2 69863280 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCAGGTACCATGCATGC -3'
(R):5'- CAGCAAAATGGTTGATCAAGGTATC -3'

Sequencing Primer
(F):5'- GCAGTGGTGGCACATACCTTTAATC -3'
(R):5'- GGTATCTTGAGGCCAACATTTC -3'
Posted On2017-12-01