Incidental Mutation 'R6251:Casq1'
ID506203
Institutional Source Beutler Lab
Gene Symbol Casq1
Ensembl Gene ENSMUSG00000007122
Gene Namecalsequestrin 1
SynonymsCSQ-1, CSQ1, CSQ, sCSQ
MMRRC Submission 044368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6251 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172209894-172219868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172216840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 140 (Y140F)
Ref Sequence ENSEMBL: ENSMUSP00000003554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000170700]
Predicted Effect probably benign
Transcript: ENSMUST00000003554
AA Change: Y140F

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: Y140F

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 402 5.3e-238 PFAM
Pfam:Thioredoxin_6 186 379 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170638
Predicted Effect probably benign
Transcript: ENSMUST00000170700
SMART Domains Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 94 9.7e-38 PFAM
Pfam:Calsequestrin 89 156 6.9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171429
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,652 S36P probably damaging Het
AF067061 T C 13: 120,263,371 probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Arhgap26 A T 18: 39,357,827 S328C probably null Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Asb3 G A 11: 31,055,559 A192T probably damaging Het
Atp10b A T 11: 43,235,746 M1110L possibly damaging Het
Cacna1i T C 15: 80,336,682 I175T probably damaging Het
Car15 A T 16: 17,837,363 I71N probably benign Het
Ccdc93 C T 1: 121,434,540 T17M possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Ciart G A 3: 95,881,011 probably benign Het
Cul5 A T 9: 53,646,794 V170D probably benign Het
Cyb5r3 T C 15: 83,154,716 D224G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Daglb T A 5: 143,489,934 L383Q probably damaging Het
Dazap2 T G 15: 100,616,983 H28Q possibly damaging Het
Dnttip2 A T 3: 122,275,256 D40V probably benign Het
Epn1 G T 7: 5,095,926 D406Y probably damaging Het
Epn1 G T 7: 5,095,936 R409L probably damaging Het
Evc T C 5: 37,300,499 T966A probably benign Het
Extl3 T C 14: 65,076,926 D269G probably damaging Het
Gfra3 TGCGC TGC 18: 34,695,811 probably null Het
Gm4778 G T 3: 94,265,901 S72I probably damaging Het
Gpr87 A T 3: 59,179,107 F326I probably damaging Het
Hivep3 C A 4: 120,094,940 P151H probably damaging Het
Kcnj14 T A 7: 45,818,016 E302V probably damaging Het
Kdm5d T C Y: 921,693 Y534H probably damaging Homo
Map3k5 T A 10: 20,138,260 probably null Het
Marc1 G A 1: 184,795,451 R271W probably damaging Het
Mdn1 A G 4: 32,748,590 T4212A probably benign Het
Ms4a6d A T 19: 11,587,140 S122R probably damaging Het
Nectin3 A T 16: 46,395,150 H76Q probably damaging Het
Notch1 C A 2: 26,474,170 E846D possibly damaging Het
Olfr1200 T C 2: 88,768,288 E9G probably damaging Het
Olfr1537 T A 9: 39,238,218 I72F possibly damaging Het
Olfr382 A G 11: 73,516,708 S164P probably benign Het
Olfr883 G GGGATTGC 9: 38,026,537 probably null Het
Olfr883 TGTTT TGTTTGCAGTTT 9: 38,026,545 probably null Het
Olfr883 GTTT GTTTGCTTTTT 9: 38,026,546 probably null Het
Olfr883 TT TTGCTGTGT 9: 38,026,548 probably null Het
Pfkl C T 10: 77,989,565 probably null Het
Pigz T C 16: 31,945,606 V494A possibly damaging Het
Pik3r4 T C 9: 105,654,048 V516A probably benign Het
Polr2b G A 5: 77,348,294 R1104K probably benign Het
Rap1a A T 3: 105,731,995 L116* probably null Het
Rnf114 T C 2: 167,514,729 *230R probably null Het
Rtl1 G T 12: 109,593,649 N585K probably benign Het
Serpinb5 G T 1: 106,875,065 R110I possibly damaging Het
Spink6 T C 18: 44,074,431 probably null Het
Stk39 A T 2: 68,307,039 probably null Het
Tcte1 A T 17: 45,535,159 T230S probably benign Het
Tctex1d2 T A 16: 32,426,909 D125E possibly damaging Het
Tecpr1 C A 5: 144,198,576 V1020L probably damaging Het
Tmc7 T C 7: 118,561,038 Y192C possibly damaging Het
Trim63 A T 4: 134,323,226 T274S probably benign Het
Wdr43 G A 17: 71,650,053 probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Casq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Casq1 APN 1 172213381 missense probably damaging 0.96
IGL02699:Casq1 APN 1 172219696 start gained probably benign
IGL02756:Casq1 APN 1 172215105 missense probably damaging 1.00
PIT4377001:Casq1 UTSW 1 172212001 missense probably benign 0.15
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0124:Casq1 UTSW 1 172210425 missense probably damaging 1.00
R0485:Casq1 UTSW 1 172210390 unclassified probably benign
R1982:Casq1 UTSW 1 172215530 missense probably damaging 1.00
R2095:Casq1 UTSW 1 172215962 missense probably benign 0.26
R2097:Casq1 UTSW 1 172210421 missense probably damaging 1.00
R3940:Casq1 UTSW 1 172219536 missense possibly damaging 0.91
R4654:Casq1 UTSW 1 172210398 unclassified probably benign
R4790:Casq1 UTSW 1 172216837 missense probably damaging 1.00
R5002:Casq1 UTSW 1 172213378 missense possibly damaging 0.50
R5187:Casq1 UTSW 1 172213074 missense possibly damaging 0.54
R5307:Casq1 UTSW 1 172219416 missense probably damaging 1.00
R5973:Casq1 UTSW 1 172219501 missense probably damaging 1.00
R6768:Casq1 UTSW 1 172219678 missense probably benign 0.04
R7380:Casq1 UTSW 1 172216849 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCATGAGAATGCATTGTATGTATGT -3'
(R):5'- CTGAACTAATTTGGGAATGAAGGGT -3'

Sequencing Primer
(F):5'- CACACACATATAGGGGCCTATATATG -3'
(R):5'- CTAATTTGGGAATGAAGGGTTTAAGG -3'
Posted On2018-03-15