Incidental Mutation 'R6251:Olfr883'
ID506229
Institutional Source Beutler Lab
Gene Symbol Olfr883
Ensembl Gene ENSMUSG00000094461
Gene Nameolfactory receptor 883
SynonymsGA_x6K02T2PVTD-31705144-31706073, MOR162-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6251 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location38025808-38026737 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTTT to GTTTGCTTTTT at 38026546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072974]
Predicted Effect probably null
Transcript: ENSMUST00000072974
SMART Domains Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-48 PFAM
Pfam:7tm_1 41 288 3.7e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,652 S36P probably damaging Het
AF067061 T C 13: 120,263,371 probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Arhgap26 A T 18: 39,357,827 S328C probably null Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Asb3 G A 11: 31,055,559 A192T probably damaging Het
Atp10b A T 11: 43,235,746 M1110L possibly damaging Het
Cacna1i T C 15: 80,336,682 I175T probably damaging Het
Car15 A T 16: 17,837,363 I71N probably benign Het
Casq1 T A 1: 172,216,840 Y140F probably benign Het
Ccdc93 C T 1: 121,434,540 T17M possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Ciart G A 3: 95,881,011 probably benign Het
Cul5 A T 9: 53,646,794 V170D probably benign Het
Cyb5r3 T C 15: 83,154,716 D224G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Daglb T A 5: 143,489,934 L383Q probably damaging Het
Dazap2 T G 15: 100,616,983 H28Q possibly damaging Het
Dnttip2 A T 3: 122,275,256 D40V probably benign Het
Epn1 G T 7: 5,095,926 D406Y probably damaging Het
Epn1 G T 7: 5,095,936 R409L probably damaging Het
Evc T C 5: 37,300,499 T966A probably benign Het
Extl3 T C 14: 65,076,926 D269G probably damaging Het
Gfra3 TGCGC TGC 18: 34,695,811 probably null Het
Gm4778 G T 3: 94,265,901 S72I probably damaging Het
Gpr87 A T 3: 59,179,107 F326I probably damaging Het
Hivep3 C A 4: 120,094,940 P151H probably damaging Het
Kcnj14 T A 7: 45,818,016 E302V probably damaging Het
Kdm5d T C Y: 921,693 Y534H probably damaging Homo
Map3k5 T A 10: 20,138,260 probably null Het
Marc1 G A 1: 184,795,451 R271W probably damaging Het
Mdn1 A G 4: 32,748,590 T4212A probably benign Het
Ms4a6d A T 19: 11,587,140 S122R probably damaging Het
Nectin3 A T 16: 46,395,150 H76Q probably damaging Het
Notch1 C A 2: 26,474,170 E846D possibly damaging Het
Olfr1200 T C 2: 88,768,288 E9G probably damaging Het
Olfr1537 T A 9: 39,238,218 I72F possibly damaging Het
Olfr382 A G 11: 73,516,708 S164P probably benign Het
Pfkl C T 10: 77,989,565 probably null Het
Pigz T C 16: 31,945,606 V494A possibly damaging Het
Pik3r4 T C 9: 105,654,048 V516A probably benign Het
Polr2b G A 5: 77,348,294 R1104K probably benign Het
Rap1a A T 3: 105,731,995 L116* probably null Het
Rnf114 T C 2: 167,514,729 *230R probably null Het
Rtl1 G T 12: 109,593,649 N585K probably benign Het
Serpinb5 G T 1: 106,875,065 R110I possibly damaging Het
Spink6 T C 18: 44,074,431 probably null Het
Stk39 A T 2: 68,307,039 probably null Het
Tcte1 A T 17: 45,535,159 T230S probably benign Het
Tctex1d2 T A 16: 32,426,909 D125E possibly damaging Het
Tecpr1 C A 5: 144,198,576 V1020L probably damaging Het
Tmc7 T C 7: 118,561,038 Y192C possibly damaging Het
Trim63 A T 4: 134,323,226 T274S probably benign Het
Wdr43 G A 17: 71,650,053 probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Olfr883
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Olfr883 APN 9 38025811 missense probably benign 0.02
IGL02092:Olfr883 APN 9 38026621 missense possibly damaging 0.80
IGL02351:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02358:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02807:Olfr883 APN 9 38026189 missense probably damaging 1.00
R0972:Olfr883 UTSW 9 38026560 missense possibly damaging 0.88
R1016:Olfr883 UTSW 9 38026691 missense probably damaging 0.98
R1818:Olfr883 UTSW 9 38026507 missense probably damaging 1.00
R4466:Olfr883 UTSW 9 38026183 missense probably damaging 0.99
R4871:Olfr883 UTSW 9 38026526 missense probably damaging 1.00
R5977:Olfr883 UTSW 9 38026540 frame shift probably null
R5979:Olfr883 UTSW 9 38026540 frame shift probably null
R6026:Olfr883 UTSW 9 38026540 frame shift probably null
R6027:Olfr883 UTSW 9 38026540 frame shift probably null
R6029:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6053:Olfr883 UTSW 9 38026541 frame shift probably null
R6092:Olfr883 UTSW 9 38026540 frame shift probably null
R6106:Olfr883 UTSW 9 38026466 missense probably damaging 1.00
R6131:Olfr883 UTSW 9 38026540 frame shift probably null
R6132:Olfr883 UTSW 9 38026540 frame shift probably null
R6133:Olfr883 UTSW 9 38026540 frame shift probably null
R6134:Olfr883 UTSW 9 38026540 frame shift probably null
R6153:Olfr883 UTSW 9 38026540 frame shift probably null
R6251:Olfr883 UTSW 9 38026537 frame shift probably null
R6251:Olfr883 UTSW 9 38026545 frame shift probably null
R6251:Olfr883 UTSW 9 38026548 frame shift probably null
R6300:Olfr883 UTSW 9 38026540 frame shift probably null
R6301:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026542 frame shift probably null
R6307:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026541 frame shift probably null
R6312:Olfr883 UTSW 9 38026546 frame shift probably null
R6312:Olfr883 UTSW 9 38026547 nonsense probably null
R6312:Olfr883 UTSW 9 38026549 frame shift probably null
R6813:Olfr883 UTSW 9 38025833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCACCATCAATGAGTTGG -3'
(R):5'- CCTCAGAAGCCATAAGATTTTAGTTCC -3'

Sequencing Primer
(F):5'- CAATGAGTTGGTGGTTTTCATTG -3'
(R):5'- CCACTTAGGTAAAACTCCTTTTCATC -3'
Posted On2018-03-15