Incidental Mutation 'R6370:Entpd2'
ID513452
Institutional Source Beutler Lab
Gene Symbol Entpd2
Ensembl Gene ENSMUSG00000015085
Gene Nameectonucleoside triphosphate diphosphohydrolase 2
SynonymsCd39l1, NTPDase2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25395874-25401321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25397417 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 47 (G47S)
Ref Sequence ENSEMBL: ENSMUSP00000028328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028328]
Predicted Effect probably damaging
Transcript: ENSMUST00000028328
AA Change: G47S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028328
Gene: ENSMUSG00000015085
AA Change: G47S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:GDA1_CD39 32 459 9.7e-104 PFAM
low complexity region 465 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148859
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display smaller circumvallate papilla size and reduced neural responses to taste stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Entpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Entpd2 APN 2 25398734 missense probably benign
IGL02869:Entpd2 APN 2 25398108 missense probably damaging 1.00
IGL03170:Entpd2 APN 2 25399481 missense probably damaging 1.00
R1280:Entpd2 UTSW 2 25399484 missense probably damaging 1.00
R2258:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2260:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2420:Entpd2 UTSW 2 25399283 missense probably benign
R2566:Entpd2 UTSW 2 25399283 missense probably benign 0.16
R4802:Entpd2 UTSW 2 25399764 unclassified probably null
R4938:Entpd2 UTSW 2 25399417 missense probably benign 0.25
R5239:Entpd2 UTSW 2 25400818 missense probably damaging 0.96
R5374:Entpd2 UTSW 2 25399726 missense probably damaging 1.00
R5739:Entpd2 UTSW 2 25399492 missense possibly damaging 0.90
R5752:Entpd2 UTSW 2 25399769 unclassified probably benign
R5881:Entpd2 UTSW 2 25400812 missense probably damaging 1.00
R6016:Entpd2 UTSW 2 25398556 missense probably damaging 0.99
R6120:Entpd2 UTSW 2 25399466 missense probably benign 0.03
R7301:Entpd2 UTSW 2 25400909 missense possibly damaging 0.88
X0009:Entpd2 UTSW 2 25398679 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTATCAACACAGGAAGTCACC -3'
(R):5'- GAACTCCTGCCTTGAATGGG -3'

Sequencing Primer
(F):5'- GGAAGTCACCTAGTCAGTCCC -3'
(R):5'- TTGAATGGGCCCCACCTAG -3'
Posted On2018-04-27