Incidental Mutation 'R6429:Olfr1205'
ID518412
Institutional Source Beutler Lab
Gene Symbol Olfr1205
Ensembl Gene ENSMUSG00000057447
Gene Nameolfactory receptor 1205
SynonymsMOR230-1, MOR230-3, Olfr1203, GA_x6K02T2Q125-50304328-50305251, GA_x6K02T2Q125-50336588-50337313
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6429 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88829737-88837104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88831525 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 136 (R136Q)
Ref Sequence ENSEMBL: ENSMUSP00000150206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076438] [ENSMUST00000215929]
Predicted Effect probably benign
Transcript: ENSMUST00000076438
AA Change: R136Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075769
Gene: ENSMUSG00000057447
AA Change: R136Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5e-45 PFAM
Pfam:7tm_1 39 285 9.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215929
AA Change: R136Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Olfr1205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Olfr1205 APN 2 88831112 unclassified probably null
IGL02079:Olfr1205 APN 2 88831647 missense probably damaging 1.00
IGL02183:Olfr1205 APN 2 88832028 missense probably benign
IGL02813:Olfr1205 APN 2 88831151 missense probably benign 0.34
IGL02839:Olfr1205 APN 2 88831648 missense probably damaging 1.00
IGL02895:Olfr1205 APN 2 88831642 missense probably damaging 1.00
R0680:Olfr1205 UTSW 2 88831780 missense probably benign
R2029:Olfr1205 UTSW 2 88831405 missense possibly damaging 0.88
R2095:Olfr1205 UTSW 2 88831290 missense probably damaging 1.00
R6158:Olfr1205 UTSW 2 88831146 missense probably damaging 1.00
R6216:Olfr1205 UTSW 2 88831311 missense probably damaging 1.00
R6240:Olfr1205 UTSW 2 88831363 missense probably benign 0.22
R6377:Olfr1205 UTSW 2 88831269 nonsense probably null
R6521:Olfr1205 UTSW 2 88831356 missense probably benign 0.03
R7065:Olfr1205 UTSW 2 88831386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTCCCATGTACTTCTTC -3'
(R):5'- ATGTGTGTATCCATGCAGGC -3'

Sequencing Primer
(F):5'- AGCCCCAAGACTCATTGTGGATG -3'
(R):5'- TGTATCCATGCAGGCAAGCTC -3'
Posted On2018-05-24