Incidental Mutation 'R6576:Pik3c3'
ID523526
Institutional Source Beutler Lab
Gene Symbol Pik3c3
Ensembl Gene ENSMUSG00000033628
Gene Namephosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms5330434F23Rik, Vps34
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6576 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location30272747-30348126 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 30342741 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091978] [ENSMUST00000115812] [ENSMUST00000131405]
Predicted Effect unknown
Transcript: ENSMUST00000091978
AA Change: I848M
SMART Domains Protein: ENSMUSP00000089601
Gene: ENSMUSG00000033628
AA Change: I848M

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 848 1.02e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115812
SMART Domains Protein: ENSMUSP00000111479
Gene: ENSMUSG00000033628

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 884 1.21e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131405
SMART Domains Protein: ENSMUSP00000128927
Gene: ENSMUSG00000033628

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 506 1.78e-84 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality between implantation and placentation, arrest prior to gastrulation, and show reduced cell proliferation. Mice homozygous for a conditional allele activated in T cells exhibit impaired naive Tcell homeostasis and mitophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Aff4 C A 11: 53,400,441 H743N probably damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Cldn15 A T 5: 136,974,616 E157D probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Epp13 G A 7: 6,277,542 probably benign Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Ripk2 A T 4: 16,131,558 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Unc13a T A 8: 71,653,478 T661S probably benign Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Pik3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pik3c3 APN 18 30303078 splice site probably benign
IGL00743:Pik3c3 APN 18 30274364 missense probably damaging 1.00
IGL01622:Pik3c3 APN 18 30290525 nonsense probably null
IGL01622:Pik3c3 APN 18 30293049 splice site probably benign
IGL01623:Pik3c3 APN 18 30290525 nonsense probably null
IGL01623:Pik3c3 APN 18 30293049 splice site probably benign
IGL01773:Pik3c3 APN 18 30277102 missense probably damaging 1.00
IGL01917:Pik3c3 APN 18 30274446 missense probably damaging 1.00
IGL02033:Pik3c3 APN 18 30312650 missense possibly damaging 0.85
IGL02465:Pik3c3 APN 18 30344060 missense probably damaging 0.97
IGL03161:Pik3c3 APN 18 30293707 missense probably benign 0.37
IGL03221:Pik3c3 APN 18 30302931 missense probably benign 0.45
H8786:Pik3c3 UTSW 18 30294343 missense probably damaging 0.99
R0089:Pik3c3 UTSW 18 30303078 splice site probably benign
R1512:Pik3c3 UTSW 18 30322236 critical splice donor site probably null
R1713:Pik3c3 UTSW 18 30323586 missense possibly damaging 0.73
R1758:Pik3c3 UTSW 18 30277010 missense probably damaging 1.00
R1822:Pik3c3 UTSW 18 30344077 critical splice donor site probably null
R1870:Pik3c3 UTSW 18 30293132 critical splice donor site probably null
R2680:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R3768:Pik3c3 UTSW 18 30333273 missense probably damaging 1.00
R3926:Pik3c3 UTSW 18 30311329 splice site probably benign
R4154:Pik3c3 UTSW 18 30311283 missense probably benign 0.35
R4293:Pik3c3 UTSW 18 30343990 missense probably damaging 1.00
R4570:Pik3c3 UTSW 18 30290550 missense possibly damaging 0.94
R4858:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R4893:Pik3c3 UTSW 18 30282000 missense probably benign 0.16
R4901:Pik3c3 UTSW 18 30302929 missense possibly damaging 0.65
R5216:Pik3c3 UTSW 18 30272976 missense probably damaging 1.00
R5358:Pik3c3 UTSW 18 30323544 missense probably damaging 1.00
R5373:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5374:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5600:Pik3c3 UTSW 18 30311293 missense probably damaging 1.00
R5680:Pik3c3 UTSW 18 30277113 nonsense probably null
R5965:Pik3c3 UTSW 18 30298580 missense probably damaging 1.00
R6492:Pik3c3 UTSW 18 30324562 missense probably damaging 1.00
R6700:Pik3c3 UTSW 18 30316901 missense probably benign 0.02
Predicted Primers
Posted On2018-06-22