Mutagenetix > Incidental Mutation

Incidental Mutation 'R6658:Prph2'

526741

Institutional Source

Beutler Lab

Gene Symbol

Prph2

Ensembl Gene

ENSMUSG00000023978

Gene Name

peripherin 2

Synonyms

Tspan22, Rd2, Nmf193, rds

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6658 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

47221404-47235859 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47230790 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 228 (T228A)

Ref Sequence

ENSEMBL: ENSMUSP00000024773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024773]

AlphaFold

P15499

Predicted Effect

probably benign
Transcript: ENSMUST00000024773
AA Change: T228A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: T228A

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	16	288	2.2e-28	PFAM
low complexity region	333	346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162469

Meta Mutation Damage Score

0.0980

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts7	A	G	9: 90,077,353 (GRCm39)	N1340S	probably damaging	Het
Akr1b1	C	T	6: 34,286,939 (GRCm39)	V206M	possibly damaging	Het
Antxr1	C	A	6: 87,261,291 (GRCm39)	R167L	probably damaging	Het
BC107364	T	C	3: 96,348,026 (GRCm39)	S88G	unknown	Het
Cfap100	T	G	6: 90,390,400 (GRCm39)	E80A	probably damaging	Het
Dhx8	C	A	11: 101,655,748 (GRCm39)	H1107Q	probably damaging	Het
Dip2c	G	A	13: 9,543,213 (GRCm39)		probably null	Het
Dpep2	A	T	8: 106,716,542 (GRCm39)	D212E	probably benign	Het
Dpep3	T	C	8: 106,705,728 (GRCm39)	T66A	probably benign	Het
Fat4	G	T	3: 38,997,077 (GRCm39)	M1765I	probably benign	Het
Gbgt1	G	A	2: 28,394,998 (GRCm39)	R212H	probably benign	Het
Gimap4	T	C	6: 48,668,338 (GRCm39)	S215P	possibly damaging	Het
Gpr161	A	T	1: 165,134,136 (GRCm39)	T133S	possibly damaging	Het
Grin2c	G	T	11: 115,149,108 (GRCm39)	S163R	possibly damaging	Het
Grip2	T	A	6: 91,763,472 (GRCm39)	N109Y	probably damaging	Het
H60c	G	A	10: 3,210,270 (GRCm39)	T93I	possibly damaging	Het
Hmgcl	A	G	4: 135,682,962 (GRCm39)	N138S	probably damaging	Het
Hoxa3	G	T	6: 52,147,058 (GRCm39)	Y398*	probably null	Het
Igkv1-132	A	G	6: 67,737,091 (GRCm39)	N19S	probably benign	Het
Ikbip	A	G	10: 90,932,181 (GRCm39)	N275S	probably benign	Het
Il7	T	A	3: 7,642,239 (GRCm39)	T33S	probably benign	Het
Iqgap2	A	T	13: 95,796,840 (GRCm39)	Y1105N	probably damaging	Het
Lmo7	A	G	14: 102,148,281 (GRCm39)	D934G	possibly damaging	Het
Mroh4	T	C	15: 74,492,978 (GRCm39)	Q310R	possibly damaging	Het
Mtmr14	C	A	6: 113,242,437 (GRCm39)	Y22*	probably null	Het
Muc5b	G	T	7: 141,422,244 (GRCm39)		probably null	Het
Naga	T	G	15: 82,214,975 (GRCm39)	K328Q	probably benign	Het
Neo1	G	A	9: 58,829,132 (GRCm39)	T589I	probably benign	Het
Nme5	A	C	18: 34,711,639 (GRCm39)	I34S	probably damaging	Het
Nrip2	T	C	6: 128,385,199 (GRCm39)	L210P	possibly damaging	Het
Nup93	A	G	8: 95,030,807 (GRCm39)	D424G	probably benign	Het
Or12e9	T	C	2: 87,202,497 (GRCm39)	V207A	probably benign	Het
Or1e26	G	A	11: 73,479,874 (GRCm39)	S230F	probably damaging	Het
Papss1	T	A	3: 131,311,696 (GRCm39)	V308E	probably benign	Het
Pilrb1	T	A	5: 137,855,789 (GRCm39)	Y34F	probably benign	Het
Pira2	T	A	7: 3,845,300 (GRCm39)	E319D	probably benign	Het
Pkhd1	G	A	1: 20,682,929 (GRCm39)	T91M	probably damaging	Het
Ranbp17	G	T	11: 33,169,214 (GRCm39)	S1000*	probably null	Het
Rbm27	A	C	18: 42,457,178 (GRCm39)	H651P	probably damaging	Het
Scyl2	A	T	10: 89,476,835 (GRCm39)	D763E	probably benign	Het
Sltm	A	G	9: 70,488,644 (GRCm39)	Y598C	probably damaging	Het
Smc2	A	T	4: 52,451,322 (GRCm39)	K322I	probably benign	Het
Tcf4	G	A	18: 69,790,873 (GRCm39)	R271Q	probably null	Het
Tex36	C	T	7: 133,196,140 (GRCm39)	D87N	probably damaging	Het
Tex44	A	C	1: 86,354,751 (GRCm39)	H220P	probably benign	Het
Tjp1	T	C	7: 64,950,825 (GRCm39)	D1683G	possibly damaging	Het
Trav7-2	T	C	14: 53,628,573 (GRCm39)	S104P	probably damaging	Het
Trim55	C	T	3: 19,745,719 (GRCm39)	R532C	probably damaging	Het
Ube3c	T	A	5: 29,807,215 (GRCm39)	L338Q	probably damaging	Het
Ush2a	A	G	1: 188,546,556 (GRCm39)	H3444R	possibly damaging	Het
Vars1	A	G	17: 35,234,717 (GRCm39)	D1182G	probably benign	Het
Vit	T	A	17: 78,930,232 (GRCm39)	I399N	possibly damaging	Het
Vmn1r16	A	T	6: 57,300,091 (GRCm39)	L177*	probably null	Het

Other mutations in Prph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Prph2	APN	17	47,230,704 (GRCm39)	missense	probably damaging	0.97
IGL01087:Prph2	APN	17	47,222,085 (GRCm39)	missense	probably damaging	0.97
PIT4480001:Prph2	UTSW	17	47,222,039 (GRCm39)	frame shift	probably null
R0025:Prph2	UTSW	17	47,230,697 (GRCm39)	missense	probably benign	0.17
R2235:Prph2	UTSW	17	47,222,092 (GRCm39)	missense	probably damaging	1.00
R3120:Prph2	UTSW	17	47,234,298 (GRCm39)	missense	possibly damaging	0.49
R3954:Prph2	UTSW	17	47,221,644 (GRCm39)	missense	probably benign	0.39
R4864:Prph2	UTSW	17	47,221,848 (GRCm39)	missense	probably benign	0.03
R4972:Prph2	UTSW	17	47,221,733 (GRCm39)	missense	possibly damaging	0.94
R5645:Prph2	UTSW	17	47,221,593 (GRCm39)	start gained	probably benign
R5687:Prph2	UTSW	17	47,234,391 (GRCm39)	missense	probably damaging	0.99
R6494:Prph2	UTSW	17	47,222,007 (GRCm39)	missense	probably benign	0.03
R7775:Prph2	UTSW	17	47,221,732 (GRCm39)	missense	possibly damaging	0.82
R7778:Prph2	UTSW	17	47,221,732 (GRCm39)	missense	possibly damaging	0.82
R7824:Prph2	UTSW	17	47,221,732 (GRCm39)	missense	possibly damaging	0.82
R8098:Prph2	UTSW	17	47,230,892 (GRCm39)	missense	probably benign	0.09
R9221:Prph2	UTSW	17	47,230,818 (GRCm39)	missense	probably damaging	1.00
R9703:Prph2	UTSW	17	47,234,447 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAAAATCTAGGTTCTCGGGGCATG -3'
(R):5'- ACCAGGTCTGTCTTCACCATG -3'

Sequencing Primer
(F):5'- CATGGGAGGATCTGCTGC -3'
(R):5'- TGTTAAACCCAAGTCTGGCAG -3'

Posted On

2018-07-23