Incidental Mutation 'R6696:Lrrc25'
ID528586
Institutional Source Beutler Lab
Gene Symbol Lrrc25
Ensembl Gene ENSMUSG00000049988
Gene Nameleucine rich repeat containing 25
SynonymsMapa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6696 (G1)
Quality Score195.009
Status Validated
Chromosome8
Chromosomal Location70616155-70621483 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 70618365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052437] [ENSMUST00000210609]
Predicted Effect probably null
Transcript: ENSMUST00000052437
SMART Domains Protein: ENSMUSP00000049686
Gene: ENSMUSG00000049988

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 51 62 N/A INTRINSIC
Pfam:LRR_8 65 110 9.6e-8 PFAM
transmembrane domain 169 191 N/A INTRINSIC
low complexity region 192 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210609
Meta Mutation Damage Score 0.564 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 G T 6: 87,465,651 H350Q probably damaging Het
Arhgap25 C A 6: 87,466,563 V305F probably damaging Het
Atg3 A T 16: 45,175,281 I126F possibly damaging Het
Best2 A T 8: 85,011,244 L174* probably null Het
Ccdc134 T A 15: 82,131,521 D67E probably damaging Het
Coasy G T 11: 101,083,101 R31L possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Eipr1 C A 12: 28,859,358 T208N probably benign Het
Epha2 A G 4: 141,321,539 T606A probably benign Het
Fan1 A T 7: 64,350,078 I853N probably damaging Het
Fbxw18 A C 9: 109,688,764 S385A probably benign Het
Galnt11 T C 5: 25,255,114 V307A probably benign Het
Gata3 A T 2: 9,874,492 Y224* probably null Het
Gm4756 C T 12: 72,619,481 A139T possibly damaging Het
Gm527 T C 12: 64,921,092 M96T possibly damaging Het
Hivep2 T C 10: 14,133,759 F1720S probably benign Het
Hltf T G 3: 20,065,306 probably null Het
Imp4 T C 1: 34,444,246 V247A probably benign Het
Iqca G A 1: 90,130,200 T259I probably benign Het
Klra6 A G 6: 130,016,733 F192L probably benign Het
Lnp1 T C 16: 56,927,786 K48E possibly damaging Het
Lrp4 A G 2: 91,497,345 D1513G probably benign Het
Macf1 T A 4: 123,509,803 Y590F probably damaging Het
Mms19 C A 19: 41,954,013 V359L probably benign Het
Mns1 G A 9: 72,452,762 R398Q probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme3 G T 17: 24,897,294 C158F possibly damaging Het
Pam T A 1: 97,885,727 H326L possibly damaging Het
Plcxd1 A G 5: 110,101,885 N151S possibly damaging Het
Prep A T 10: 45,153,078 N525Y probably damaging Het
Rab11fip5 T C 6: 85,341,946 I654V possibly damaging Het
Sbf2 T A 7: 110,560,298 Q35L probably benign Het
Shcbp1 A G 8: 4,739,262 F519S probably damaging Het
Slc18a3 T C 14: 32,464,313 I38V possibly damaging Het
Slc5a2 A T 7: 128,270,043 I332F probably damaging Het
Slc7a7 C T 14: 54,377,761 probably null Het
Srbd1 C T 17: 86,139,191 V47I possibly damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tgfbr3 C T 5: 107,136,930 V618I probably benign Het
Tmem191c C T 16: 17,283,022 probably null Het
Tmem67 C A 4: 12,061,754 probably null Het
Tmem94 C T 11: 115,791,988 A617V probably damaging Het
Vmn1r71 T A 7: 10,748,474 I96F probably damaging Het
Vmn2r7 A T 3: 64,707,074 F440I probably benign Het
Wdr7 A G 18: 63,739,330 Q445R probably benign Het
Wnk1 A G 6: 119,948,282 L1407P probably damaging Het
Other mutations in Lrrc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Lrrc25 APN 8 70617787 missense possibly damaging 0.83
IGL02263:Lrrc25 APN 8 70617822 missense probably benign 0.27
IGL02354:Lrrc25 APN 8 70617827 missense probably benign
IGL02361:Lrrc25 APN 8 70617827 missense probably benign
R0320:Lrrc25 UTSW 8 70618246 missense probably benign 0.00
R1863:Lrrc25 UTSW 8 70617946 missense possibly damaging 0.83
R4816:Lrrc25 UTSW 8 70618076 missense probably benign
R7169:Lrrc25 UTSW 8 70617787 missense probably benign 0.27
R7394:Lrrc25 UTSW 8 70618180 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCAGCAAAGCCCAGATGTCC -3'
(R):5'- CTGGCCCCTTGGAAACTTTC -3'

Sequencing Primer
(F):5'- GATGTCCCCACACGATATCC -3'
(R):5'- GAAACTTTCCAAACTCTTACCCC -3'
Posted On2018-07-24