Incidental Mutation 'R6768:Fpgs'
ID532025
Institutional Source Beutler Lab
Gene Symbol Fpgs
Ensembl Gene ENSMUSG00000009566
Gene Namefolylpolyglutamyl synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6768 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32682609-32704145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32686623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 331 (S331P)
Ref Sequence ENSEMBL: ENSMUSP00000028148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000028148] [ENSMUST00000113272] [ENSMUST00000127812] [ENSMUST00000146498] [ENSMUST00000167841]
Predicted Effect probably benign
Transcript: ENSMUST00000009705
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028148
AA Change: S331P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566
AA Change: S331P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113272
SMART Domains Protein: ENSMUSP00000108897
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
ZP 361 568 1.29e-2 SMART
transmembrane domain 586 608 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127812
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000146498
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167841
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,421,958 H19Q probably damaging Het
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Casq1 C T 1: 172,219,678 D5N probably benign Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Colec11 T C 12: 28,595,101 probably null Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Mtf1 G A 4: 124,837,785 D385N probably benign Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sdhb A G 4: 140,979,053 E267G probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Stk11ip T A 1: 75,532,635 C766S probably benign Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in Fpgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Fpgs APN 2 32686547 unclassified probably benign
IGL00493:Fpgs APN 2 32687997 missense possibly damaging 0.49
IGL02397:Fpgs APN 2 32685789 missense probably damaging 1.00
IGL02867:Fpgs APN 2 32685879 unclassified probably benign
IGL02889:Fpgs APN 2 32685879 unclassified probably benign
IGL03082:Fpgs APN 2 32685757 nonsense probably null
IGL03126:Fpgs APN 2 32683123 missense possibly damaging 0.86
R0243:Fpgs UTSW 2 32692494 nonsense probably null
R0312:Fpgs UTSW 2 32684801 missense probably damaging 0.99
R1326:Fpgs UTSW 2 32692580 unclassified probably null
R1558:Fpgs UTSW 2 32685840 missense possibly damaging 0.77
R1624:Fpgs UTSW 2 32691188 critical splice donor site probably null
R1934:Fpgs UTSW 2 32687981 missense probably damaging 1.00
R3706:Fpgs UTSW 2 32687996 missense probably damaging 1.00
R4439:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4440:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4868:Fpgs UTSW 2 32692661 missense probably damaging 1.00
R4979:Fpgs UTSW 2 32687367 unclassified probably benign
R5279:Fpgs UTSW 2 32692767 intron probably benign
R6337:Fpgs UTSW 2 32687941 nonsense probably null
R6648:Fpgs UTSW 2 32684787 nonsense probably null
R6668:Fpgs UTSW 2 32687606 missense probably benign 0.05
R7134:Fpgs UTSW 2 32686629 missense probably benign 0.25
R7360:Fpgs UTSW 2 32693993 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAGGCCAGAGAGGAATGCTCAC -3'
(R):5'- TAATGCTGCCTTGGCCTTG -3'

Sequencing Primer
(F):5'- AGAGGAATGCTCACCCCGAG -3'
(R):5'- TTGCAGCTGGCCCACTG -3'
Posted On2018-08-29