Incidental Mutation 'R6830:Trim40'
ID534369
Institutional Source Beutler Lab
Gene Symbol Trim40
Ensembl Gene ENSMUSG00000073399
Gene Nametripartite motif-containing 40
SynonymsLOC195359, LOC240093, LOC333872
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36881598-36890123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36888850 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 112 (Y112C)
Ref Sequence ENSEMBL: ENSMUSP00000084400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087158] [ENSMUST00000172711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087158
AA Change: Y112C

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084400
Gene: ENSMUSG00000073399
AA Change: Y112C

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 1.1e-6 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172711
AA Change: Y112C

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133581
Gene: ENSMUSG00000073399
AA Change: Y112C

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 3.4e-7 PFAM
coiled coil region 106 150 N/A INTRINSIC
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) protein family. The encoded protein may play a role as a negative regulator against inflammation and carcinogenesis in the gastrointestinal tract. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zfp84 A G 7: 29,776,486 Y201C probably benign Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Trim40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Trim40 APN 17 36882397 makesense probably null
IGL01085:Trim40 APN 17 36883241 missense probably benign 0.01
IGL02071:Trim40 APN 17 36889178 missense probably benign
IGL02343:Trim40 APN 17 36889138 missense probably benign 0.03
R0116:Trim40 UTSW 17 36883147 critical splice donor site probably null
R1853:Trim40 UTSW 17 36889078 missense probably damaging 1.00
R2216:Trim40 UTSW 17 36888983 missense probably benign 0.10
R4649:Trim40 UTSW 17 36882639 splice site probably null
R4903:Trim40 UTSW 17 36883225 missense possibly damaging 0.95
R5384:Trim40 UTSW 17 36888865 missense probably damaging 0.99
R5680:Trim40 UTSW 17 36888982 missense probably damaging 0.99
R5969:Trim40 UTSW 17 36882427 missense probably benign
R7008:Trim40 UTSW 17 36883976 missense probably damaging 1.00
R7112:Trim40 UTSW 17 36882642 missense probably null 1.00
R7283:Trim40 UTSW 17 36882662 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGTCTTCACCATCATAGTAGCAGG -3'
(R):5'- ATTCTCAGCTGCCCAGTCTG -3'

Sequencing Primer
(F):5'- TAGTAGCAGGATCACCTACATCG -3'
(R):5'- AGTCTGCAGGAAGCCATGTTC -3'
Posted On2018-09-12