Incidental Mutation 'R6933:4932443I19Rik'
List |< first << previous [record 33 of 1259] next >> last >|
ID540160
Institutional Source Beutler Lab
Gene Symbol 4932443I19Rik
Ensembl Gene ENSMUSG00000090336
Gene NameRIKEN cDNA 4932443I19 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6933 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location13705889-13743414 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CA to CAA at 13734865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166277] [ENSMUST00000214337]
Predicted Effect probably null
Transcript: ENSMUST00000166277
SMART Domains Protein: ENSMUSP00000127953
Gene: ENSMUSG00000090336

DomainStartEndE-ValueType
Pfam:KIAA1430 26 98 5.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214337
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G T 10: 69,904,212 K814N probably damaging Het
Anks1b A G 10: 90,069,490 H231R probably damaging Het
Anks6 A G 4: 47,049,164 V247A probably benign Het
Antxrl A G 14: 34,075,771 N568D possibly damaging Het
Ccnl1 T C 3: 65,947,952 T366A probably benign Het
Ccr2 T G 9: 124,106,124 L147R probably damaging Het
Cdc40 A G 10: 40,844,996 V318A probably damaging Het
Clk3 A T 9: 57,761,849 Y31N probably damaging Het
Cmya5 T C 13: 93,095,136 Y1148C probably benign Het
Cntnap5b T C 1: 100,383,450 V927A probably benign Het
Dync1i1 A C 6: 5,913,333 T217P probably damaging Het
Elovl4 A G 9: 83,785,100 V68A probably damaging Het
Ep400 C A 5: 110,665,862 K2890N probably damaging Het
Fam114a2 T C 11: 57,484,071 I481V probably benign Het
Fam83e A G 7: 45,722,394 T72A probably benign Het
Fnip2 A T 3: 79,518,111 M59K probably benign Het
Lrpprc T C 17: 84,722,703 K1089R probably benign Het
Mndal T A 1: 173,875,683 E52V probably damaging Het
Myom1 C A 17: 71,052,671 T446K probably damaging Het
Nbea A T 3: 55,723,610 F2199I possibly damaging Het
Nr1h2 A T 7: 44,550,013 L438Q probably damaging Het
Olfr668 A G 7: 104,925,123 C214R probably benign Het
Pet117 T A 2: 144,369,099 V13E possibly damaging Het
Pnpla8 A G 12: 44,283,427 E254G probably benign Het
Polr2a T C 11: 69,736,177 E1485G probably damaging Het
Polr2a C T 11: 69,739,467 R1258Q probably benign Het
Rapgef2 A T 3: 79,085,959 Y889N probably damaging Het
Sbf1 G A 15: 89,300,369 R1115C probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shank2 A T 7: 144,091,778 T366S probably benign Het
Slc22a23 T C 13: 34,305,180 I241V probably benign Het
Sox11 G T 12: 27,341,494 S305R probably damaging Het
Sox21 T C 14: 118,235,313 H108R possibly damaging Het
Taok1 A T 11: 77,555,653 S417T probably benign Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Traf3 T C 12: 111,255,224 V273A possibly damaging Het
Tspyl3 T C 2: 153,225,283 T12A probably benign Het
Vmn2r86 A T 10: 130,446,257 I830N probably damaging Het
Vps26b A T 9: 27,015,317 F129I possibly damaging Het
Washc3 A G 10: 88,201,852 N24S probably damaging Het
Xirp2 C A 2: 67,514,857 Q2481K probably benign Het
Zfhx4 T C 3: 5,412,987 V3554A probably damaging Het
Other mutations in 4932443I19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4723:4932443I19Rik UTSW 8 13735937 missense probably damaging 0.97
R5741:4932443I19Rik UTSW 8 13734835 missense possibly damaging 0.81
R5921:4932443I19Rik UTSW 8 13734840 missense probably damaging 1.00
R6254:4932443I19Rik UTSW 8 13706043 missense possibly damaging 0.87
R6932:4932443I19Rik UTSW 8 13734865 frame shift probably null
R6935:4932443I19Rik UTSW 8 13734865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTCTGAGGGTTGCTGAAATCC -3'
(R):5'- GGGCAGAACAGGTTCAGTTAGC -3'

Sequencing Primer
(F):5'- GGGTTGCTGAAATCCAAGTCAAATC -3'
(R):5'- CAGAACAGGTTCAGTTAGCCCTTTG -3'
Posted On2018-11-06