Incidental Mutation 'R6933:Lrpprc'
ID 540184
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 045048-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6933 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85030131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1089 (K1089R)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect probably benign
Transcript: ENSMUST00000112308
AA Change: K1089R

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: K1089R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Meta Mutation Damage Score 0.1387 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G T 10: 69,740,042 (GRCm39) K814N probably damaging Het
Anks1b A G 10: 89,905,352 (GRCm39) H231R probably damaging Het
Anks6 A G 4: 47,049,164 (GRCm39) V247A probably benign Het
Antxrl A G 14: 33,797,728 (GRCm39) N568D possibly damaging Het
Ccnl1 T C 3: 65,855,373 (GRCm39) T366A probably benign Het
Ccr2 T G 9: 123,906,161 (GRCm39) L147R probably damaging Het
Cdc40 A G 10: 40,720,992 (GRCm39) V318A probably damaging Het
Cfap61 T A 2: 145,792,970 (GRCm39) probably null Het
Cfap97d2 CA CAA 8: 13,784,865 (GRCm39) probably null Het
Clk3 A T 9: 57,669,132 (GRCm39) Y31N probably damaging Het
Cmya5 T C 13: 93,231,644 (GRCm39) Y1148C probably benign Het
Cntnap5b T C 1: 100,311,175 (GRCm39) V927A probably benign Het
Dync1i1 A C 6: 5,913,333 (GRCm39) T217P probably damaging Het
Elovl4 A G 9: 83,667,153 (GRCm39) V68A probably damaging Het
Ep400 C A 5: 110,813,728 (GRCm39) K2890N probably damaging Het
Fam114a2 T C 11: 57,374,897 (GRCm39) I481V probably benign Het
Fam83e A G 7: 45,371,818 (GRCm39) T72A probably benign Het
Fnip2 A T 3: 79,425,418 (GRCm39) M59K probably benign Het
Mndal T A 1: 173,703,249 (GRCm39) E52V probably damaging Het
Myom1 C A 17: 71,359,666 (GRCm39) T446K probably damaging Het
Nbea A T 3: 55,631,031 (GRCm39) F2199I possibly damaging Het
Nr1h2 A T 7: 44,199,437 (GRCm39) L438Q probably damaging Het
Or52n2c A G 7: 104,574,330 (GRCm39) C214R probably benign Het
Pet117 T A 2: 144,211,019 (GRCm39) V13E possibly damaging Het
Pnpla8 A G 12: 44,330,210 (GRCm39) E254G probably benign Het
Polr2a T C 11: 69,627,003 (GRCm39) E1485G probably damaging Het
Polr2a C T 11: 69,630,293 (GRCm39) R1258Q probably benign Het
Ptpn4 T C 1: 119,700,878 (GRCm39) probably benign Het
Rapgef2 A T 3: 78,993,266 (GRCm39) Y889N probably damaging Het
Sbf1 G A 15: 89,184,572 (GRCm39) R1115C probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Shank2 A T 7: 143,645,515 (GRCm39) T366S probably benign Het
Slc22a23 T C 13: 34,489,163 (GRCm39) I241V probably benign Het
Sox11 G T 12: 27,391,493 (GRCm39) S305R probably damaging Het
Sox21 T C 14: 118,472,725 (GRCm39) H108R possibly damaging Het
Taok1 A T 11: 77,446,479 (GRCm39) S417T probably benign Het
Tg C T 15: 66,636,158 (GRCm39) R582C possibly damaging Het
Traf3 T C 12: 111,221,658 (GRCm39) V273A possibly damaging Het
Tspyl3 T C 2: 153,067,203 (GRCm39) T12A probably benign Het
Vmn2r86 A T 10: 130,282,126 (GRCm39) I830N probably damaging Het
Vps26b A T 9: 26,926,613 (GRCm39) F129I possibly damaging Het
Washc3 A G 10: 88,037,714 (GRCm39) N24S probably damaging Het
Xirp2 C A 2: 67,345,201 (GRCm39) Q2481K probably benign Het
Zfhx4 T C 3: 5,478,047 (GRCm39) V3554A probably damaging Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCAAATGTGACTGTTGGTGTC -3'
(R):5'- CCGTGGACAGGAATATATTTTGGG -3'

Sequencing Primer
(F):5'- TGTTATCCCAGCACTCGAGAG -3'
(R):5'- GGACTTTTTGTTTTGCTAGTTCAG -3'
Posted On 2018-11-06