Incidental Mutation 'R7034:Calcr'
ID546521
Institutional Source Beutler Lab
Gene Symbol Calcr
Ensembl Gene ENSMUSG00000023964
Gene Namecalcitonin receptor
SynonymsClr
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location3685680-3764714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3692543 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 400 (Q400L)
Ref Sequence ENSEMBL: ENSMUSP00000130083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075644] [ENSMUST00000115622] [ENSMUST00000168592] [ENSMUST00000170266] [ENSMUST00000171613]
Predicted Effect probably damaging
Transcript: ENSMUST00000075644
AA Change: Q437L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075070
Gene: ENSMUSG00000023964
AA Change: Q437L

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 5.2e-85 PFAM
Pfam:Dicty_CAR 259 410 5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115622
AA Change: Q400L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111285
Gene: ENSMUSG00000023964
AA Change: Q400L

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168592
AA Change: Q400L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130243
Gene: ENSMUSG00000023964
AA Change: Q400L

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170266
AA Change: Q437L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132124
Gene: ENSMUSG00000023964
AA Change: Q437L

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 2.2e-84 PFAM
Pfam:Dicty_CAR 257 399 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171613
AA Change: Q400L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130083
Gene: ENSMUSG00000023964
AA Change: Q400L

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Haploinsufficiency may result in increased bone density due to increased bone formation. Homozygous inactivation may result in embryonic lethality. Mice homozygous for another disruption allele at this locus show a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Mug1 A G 6: 121,873,644 T700A probably benign Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Nwd2 A T 5: 63,804,915 N614I probably damaging Het
Olfr794 G A 10: 129,571,072 C139Y possibly damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcnx2 T C 8: 125,785,302 T1422A probably damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Ppl A G 16: 5,087,502 V1643A probably benign Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Calcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Calcr APN 6 3717196 missense probably damaging 1.00
IGL01146:Calcr APN 6 3700144 missense possibly damaging 0.88
IGL02253:Calcr APN 6 3707523 missense probably benign 0.12
IGL02567:Calcr APN 6 3691564 missense probably damaging 1.00
IGL02729:Calcr APN 6 3707595 missense probably benign
IGL03062:Calcr APN 6 3693718 missense probably benign 0.08
R0111:Calcr UTSW 6 3717157 missense probably damaging 1.00
R0561:Calcr UTSW 6 3692630 missense probably damaging 0.99
R1013:Calcr UTSW 6 3692621 missense probably damaging 1.00
R1628:Calcr UTSW 6 3700251 missense possibly damaging 0.53
R2152:Calcr UTSW 6 3687615 missense probably benign 0.03
R2206:Calcr UTSW 6 3717133 missense probably damaging 0.98
R2207:Calcr UTSW 6 3717133 missense probably damaging 0.98
R3403:Calcr UTSW 6 3687604 missense probably benign 0.04
R3781:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3782:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3851:Calcr UTSW 6 3693735 missense probably damaging 1.00
R3852:Calcr UTSW 6 3693735 missense probably damaging 1.00
R4190:Calcr UTSW 6 3717106 missense possibly damaging 0.82
R4387:Calcr UTSW 6 3707581 missense probably damaging 0.98
R4402:Calcr UTSW 6 3708484 critical splice donor site probably null
R4403:Calcr UTSW 6 3708484 critical splice donor site probably null
R4494:Calcr UTSW 6 3708484 critical splice donor site probably null
R4495:Calcr UTSW 6 3708484 critical splice donor site probably null
R4745:Calcr UTSW 6 3692576 missense probably damaging 0.99
R4857:Calcr UTSW 6 3708511 missense probably benign 0.29
R4883:Calcr UTSW 6 3714705 missense probably damaging 1.00
R5168:Calcr UTSW 6 3708610 missense probably benign 0.00
R5375:Calcr UTSW 6 3714651 missense probably benign 0.00
R5643:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5644:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5688:Calcr UTSW 6 3714730 synonymous probably null
R5799:Calcr UTSW 6 3707592 missense probably benign 0.13
R5920:Calcr UTSW 6 3722994 missense probably damaging 0.97
R6249:Calcr UTSW 6 3692711 missense possibly damaging 0.49
R6329:Calcr UTSW 6 3687621 missense probably damaging 1.00
R6357:Calcr UTSW 6 3714710 missense probably benign 0.00
R6365:Calcr UTSW 6 3711455 missense probably benign 0.00
R6393:Calcr UTSW 6 3708586 missense probably damaging 1.00
R6547:Calcr UTSW 6 3717177 missense probably damaging 1.00
R7208:Calcr UTSW 6 3687612 missense probably benign 0.00
R7342:Calcr UTSW 6 3691536 missense probably benign 0.03
R7430:Calcr UTSW 6 3708586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGGGGCCTGTGTATCAATAAAG -3'
(R):5'- CAACATTGTCCGCGTGCTTG -3'

Sequencing Primer
(F):5'- GGCTATGCATTTTGACTCCT -3'
(R):5'- TTGTGACCAAGATGAGGCAAACC -3'
Posted On2019-05-13