Incidental Mutation 'R6880:Foxd1'
ID548882
Institutional Source Beutler Lab
Gene Symbol Foxd1
Ensembl Gene ENSMUSG00000078302
Gene Nameforkhead box D1
SynonymsHfh10, BF-2, FREAC4, Hfhbf2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6880 (G1)
Quality Score54.0072
Status Validated
Chromosome13
Chromosomal Location98354242-98359305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98354717 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 33 (D33A)
Ref Sequence ENSEMBL: ENSMUSP00000100725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105098]
Predicted Effect unknown
Transcript: ENSMUST00000105098
AA Change: D33A
SMART Domains Protein: ENSMUSP00000100725
Gene: ENSMUSG00000078302
AA Change: D33A

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 83 124 N/A INTRINSIC
FH 128 218 7.63e-61 SMART
low complexity region 231 280 N/A INTRINSIC
low complexity region 282 323 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 378 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. Studies of the orthologous mouse protein indicate that it functions in kidney development by promoting nephron progenitor differentiation, and it also functions in the development of the retina and optic chiasm. It may also regulate inflammatory reactions and prevent autoimmunity. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for this targeted mutation die within 24 hours after birth with severe defects in nephrogenesis, and abnormal development of the renal collecting system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Foxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1674:Foxd1 UTSW 13 98354839 missense unknown
R2328:Foxd1 UTSW 13 98355152 missense probably damaging 1.00
R3747:Foxd1 UTSW 13 98355916 missense unknown
R3750:Foxd1 UTSW 13 98355916 missense unknown
R5524:Foxd1 UTSW 13 98355904 missense unknown
R5846:Foxd1 UTSW 13 98355041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTCAAGTCTAGAGCGC -3'
(R):5'- TGATGAGCGCGATGTACGAG -3'

Sequencing Primer
(F):5'- AGCCCTGCTCGCCAAGTAG -3'
(R):5'- TCACCAGCGGATTCTTAGCG -3'
Posted On2019-05-15