Incidental Mutation 'R0604:1700007K13Rik'
List |< first << previous [record 24 of 18487] next >> last >|
ID55578
Institutional Source Beutler Lab
Gene Symbol 1700007K13Rik
Ensembl Gene ENSMUSG00000026831
Gene NameRIKEN cDNA 1700007K13 gene
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28462001-28466332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28466091 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 60 (R60L)
Ref Sequence ENSEMBL: ENSMUSP00000083557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038600] [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably benign
Transcript: ENSMUST00000038600
SMART Domains Protein: ENSMUSP00000036725
Gene: ENSMUSG00000035772

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 81 182 4.6e-23 PFAM
Pfam:Ribosomal_S2 180 257 7.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086370
AA Change: R60L

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831
AA Change: R60L

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126242
Predicted Effect possibly damaging
Transcript: ENSMUST00000127683
AA Change: R60L

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831
AA Change: R60L

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146332
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe laterality defects, including situs inversus totalis and heterotaxy with randomized situs and left and right isomerisms. Homozygous embryos with isomerisms die in utero due to associated cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in 1700007K13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:1700007K13Rik APN 2 28465180 missense probably damaging 0.97
R0423:1700007K13Rik UTSW 2 28466024 splice site probably benign
R6580:1700007K13Rik UTSW 2 28466050 missense probably damaging 1.00
R6819:1700007K13Rik UTSW 2 28466110
Predicted Primers PCR Primer
(F):5'- TTTGACCTCAGTAGCCACAGCCAC -3'
(R):5'- TTCATTGCCTAGCAACAGGACGCC -3'

Sequencing Primer
(F):5'- GTAGCCACAGCCACTTGAGAG -3'
(R):5'- CAGGCACAGACTTGATCTGG -3'
Posted On2013-07-11