Incidental Mutation 'PIT4810001:Zzef1'
ID556866
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #PIT4810001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72850745 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 738 (F738L)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: F738L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: F738L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: F738L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: F738L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: F738L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.1%
  • 20x: 72.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,291,692 G54D possibly damaging Het
4932438H23Rik A G 16: 91,055,934 S105P probably damaging Het
Adtrp C T 13: 41,828,248 W48* probably null Het
Agxt2 A T 15: 10,399,065 M413L probably benign Het
Ahnak2 T A 12: 112,785,594 D211V Het
Aplnr T A 2: 85,137,284 C218S probably damaging Het
Arhgdib T A 6: 136,924,164 E189V probably damaging Het
Atp10a T C 7: 58,813,848 I1043T probably damaging Het
Atp13a5 C T 16: 29,314,564 C468Y probably damaging Het
Cars2 A T 8: 11,514,699 C459S probably benign Het
Ccr3 T A 9: 124,029,608 Y327N probably benign Het
Ceacam1 T A 7: 25,471,975 I355F probably damaging Het
Celsr3 T C 9: 108,845,733 L2773P probably damaging Het
Ces2g A T 8: 104,964,889 H192L possibly damaging Het
Cfap157 A G 2: 32,781,432 F121L probably damaging Het
Champ1 G A 8: 13,879,234 S464N probably benign Het
Clasp2 T A 9: 113,906,067 L990Q probably damaging Het
Col6a3 A T 1: 90,778,794 L2806Q unknown Het
Cpz T C 5: 35,508,192 E435G possibly damaging Het
Crbn T A 6: 106,784,479 R233* probably null Het
Ctc1 C T 11: 69,022,526 T116I probably benign Het
Cyp4f17 T C 17: 32,524,600 S314P possibly damaging Het
Dmxl1 A G 18: 49,931,963 E2625G probably damaging Het
Dock7 T A 4: 98,945,559 R1874* probably null Het
E130311K13Rik A T 3: 63,915,701 L174* probably null Het
Etnppl A G 3: 130,620,714 D86G probably benign Het
Fbxw18 C A 9: 109,676,890 E438* probably null Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Gpr155 A C 2: 73,348,263 L727R probably benign Het
Gpr158 C G 2: 21,826,871 D927E probably benign Het
Igsf10 T C 3: 59,318,482 Y2590C probably damaging Het
Ints7 A G 1: 191,596,236 D207G probably damaging Het
Iqsec1 A G 6: 90,670,491 L743P probably damaging Het
Kansl1l A T 1: 66,762,149 S553T probably damaging Het
Klhl14 G T 18: 21,557,823 Y523* probably null Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Lrrc3b A G 14: 15,358,273 V111A probably benign Het
Maml2 A G 9: 13,620,024 N178S Het
Megf8 G A 7: 25,342,285 C1208Y probably damaging Het
Mocos A G 18: 24,686,702 D667G probably damaging Het
Nid2 A G 14: 19,810,090 T1359A possibly damaging Het
Nup210 T C 6: 91,030,124 E1357G probably damaging Het
Olfr1239 A T 2: 89,417,953 H153Q probably damaging Het
Olfr1411 T A 1: 92,597,154 F212I probably benign Het
Olfr715 A T 7: 107,128,559 M278K probably benign Het
Pign A G 1: 105,597,762 V447A possibly damaging Het
Pomp T C 5: 147,869,419 L57P probably benign Het
Rbms3 T A 9: 117,056,793 Y128F probably damaging Het
Slc12a4 A G 8: 105,951,596 F322L probably benign Het
Slc16a9 T A 10: 70,283,932 C468* probably null Het
Slc22a18 A G 7: 143,492,931 I271V probably benign Het
Slc25a41 A G 17: 57,039,933 V20A possibly damaging Het
Smim7 A T 8: 72,571,013 L6Q probably damaging Het
Snx29 T C 16: 11,400,981 V227A probably damaging Het
Sowaha A T 11: 53,478,463 L482Q probably damaging Het
Srp19 A G 18: 34,334,470 Y68C probably damaging Het
Tecr A G 8: 83,572,255 S298P probably damaging Het
Terb2 T A 2: 122,204,898 I200N probably damaging Het
Togaram1 G A 12: 64,983,512 S1030N probably damaging Het
Trav7n-4 A G 14: 53,091,736 M68V probably benign Het
Tshz1 A C 18: 84,013,250 L1011R possibly damaging Het
Tubb3 A G 8: 123,421,657 E443G possibly damaging Het
Uba5 A T 9: 104,055,197 I189K probably damaging Het
Vasn A G 16: 4,650,045 T619A probably benign Het
Wbp1l A G 19: 46,654,322 D254G probably benign Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 synonymous probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTAGTTCTTGATGGTGAAGTTCCTC -3'
(R):5'- TTCCACAGACTGGTGCCAAAG -3'

Sequencing Primer
(F):5'- GAAGTTCCTCTGCACCCG -3'
(R):5'- TGGTGCCAAAGTCCACTC -3'
Posted On2019-06-07