Incidental Mutation 'R7164:Zfp707'
ID557821
Institutional Source Beutler Lab
Gene Symbol Zfp707
Ensembl Gene ENSMUSG00000034429
Gene Namezinc finger protein 707
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7164 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location75969123-75975868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75975118 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 339 (E339G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109966] [ENSMUST00000109967] [ENSMUST00000182172] [ENSMUST00000183130] [ENSMUST00000229652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109966
AA Change: E333G

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105592
Gene: ENSMUSG00000034429
AA Change: E333G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
KRAB 39 99 2.42e-31 SMART
ZnF_C2H2 189 211 9.96e-1 SMART
ZnF_C2H2 217 239 9.08e-4 SMART
ZnF_C2H2 245 267 3.58e-2 SMART
ZnF_C2H2 273 295 1.04e-3 SMART
ZnF_C2H2 301 323 2.09e-3 SMART
ZnF_C2H2 329 351 9.58e-3 SMART
ZnF_C2H2 357 379 1.28e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109967
AA Change: E287G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105593
Gene: ENSMUSG00000034429
AA Change: E287G

DomainStartEndE-ValueType
KRAB 4 53 3.59e-16 SMART
ZnF_C2H2 143 165 9.96e-1 SMART
ZnF_C2H2 171 193 9.08e-4 SMART
ZnF_C2H2 199 221 3.58e-2 SMART
ZnF_C2H2 227 249 1.04e-3 SMART
ZnF_C2H2 255 277 2.09e-3 SMART
ZnF_C2H2 283 305 9.58e-3 SMART
ZnF_C2H2 311 333 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145100
SMART Domains Protein: ENSMUSP00000120565
Gene: ENSMUSG00000034429

DomainStartEndE-ValueType
KRAB 23 83 2.42e-31 SMART
ZnF_C2H2 173 195 9.96e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147641
AA Change: E339G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119705
Gene: ENSMUSG00000034429
AA Change: E339G

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
KRAB 46 106 2.42e-31 SMART
ZnF_C2H2 196 218 9.96e-1 SMART
ZnF_C2H2 224 246 9.08e-4 SMART
ZnF_C2H2 252 274 3.58e-2 SMART
ZnF_C2H2 280 302 1.04e-3 SMART
ZnF_C2H2 308 330 2.09e-3 SMART
ZnF_C2H2 336 358 9.58e-3 SMART
ZnF_C2H2 364 386 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182172
SMART Domains Protein: ENSMUSP00000138510
Gene: ENSMUSG00000098176

DomainStartEndE-ValueType
Pfam:DUF4515 67 146 9.4e-6 PFAM
low complexity region 180 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183130
SMART Domains Protein: ENSMUSP00000138115
Gene: ENSMUSG00000098176

DomainStartEndE-ValueType
Pfam:DUF4515 67 260 2.3e-25 PFAM
low complexity region 265 288 N/A INTRINSIC
low complexity region 433 444 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229652
AA Change: E266G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Other mutations in Zfp707
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Zfp707 APN 15 75975195 missense probably damaging 1.00
R0505:Zfp707 UTSW 15 75975256 missense probably damaging 1.00
R0638:Zfp707 UTSW 15 75975129 missense possibly damaging 0.80
R1389:Zfp707 UTSW 15 75974616 missense probably damaging 0.99
R4806:Zfp707 UTSW 15 75973151 nonsense probably null
R6810:Zfp707 UTSW 15 75974899 missense probably damaging 1.00
R6823:Zfp707 UTSW 15 75969723 unclassified probably benign
R7105:Zfp707 UTSW 15 75974746 missense
R7124:Zfp707 UTSW 15 75973549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAAAGCCCTTCTGCTGTGAG -3'
(R):5'- CAGGACCTGCTACACTTCTC -3'

Sequencing Primer
(F):5'- TTCAGCTTGAAGGACCGC -3'
(R):5'- ACTTCTCCTCGCCCGTGAG -3'
Posted On2019-06-26