Incidental Mutation 'R7191:Syde2'
ID559583
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Namesynapse defective 1, Rho GTPase, homolog 2 (C. elegans)
SynonymsC430017H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145987870-146021720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146002358 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 951 (M951T)
Ref Sequence ENSEMBL: ENSMUSP00000041897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
Predicted Effect probably benign
Transcript: ENSMUST00000039517
AA Change: M951T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863
AA Change: M951T

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200546
AA Change: M683T

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863
AA Change: M683T

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212479
AA Change: M684T

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 146014341 missense possibly damaging 0.76
IGL01624:Syde2 APN 3 146007035 missense probably damaging 1.00
IGL02059:Syde2 APN 3 146002172 missense possibly damaging 0.77
IGL02195:Syde2 APN 3 146002156 missense probably damaging 1.00
IGL02498:Syde2 APN 3 145998689 missense probably benign 0.08
IGL02609:Syde2 APN 3 145998520 missense probably benign 0.00
IGL02721:Syde2 APN 3 146002004 missense probably damaging 1.00
IGL02932:Syde2 APN 3 146001476 missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145989179 splice site probably benign
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0413:Syde2 UTSW 3 146007132 missense probably damaging 1.00
R0505:Syde2 UTSW 3 146014380 missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145989170 critical splice donor site probably null
R0646:Syde2 UTSW 3 146014249 splice site probably null
R1535:Syde2 UTSW 3 146002421 splice site probably benign
R1914:Syde2 UTSW 3 146014316 nonsense probably null
R1915:Syde2 UTSW 3 146014316 nonsense probably null
R1997:Syde2 UTSW 3 145998991 missense probably benign 0.08
R2012:Syde2 UTSW 3 145988408 missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145998486 missense possibly damaging 0.52
R2220:Syde2 UTSW 3 146001958 missense probably benign 0.07
R2990:Syde2 UTSW 3 146001497 missense probably damaging 0.97
R4022:Syde2 UTSW 3 146015725 missense probably benign 0.25
R5077:Syde2 UTSW 3 146002009 missense probably damaging 1.00
R5084:Syde2 UTSW 3 146001409 frame shift probably null
R5084:Syde2 UTSW 3 146001408 nonsense probably null
R5086:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146007126 missense probably damaging 1.00
R5101:Syde2 UTSW 3 146015638 missense probably damaging 1.00
R5211:Syde2 UTSW 3 146001338 missense probably benign 0.01
R5842:Syde2 UTSW 3 145999020 missense probably benign 0.00
R6025:Syde2 UTSW 3 146007141 splice site probably null
R6352:Syde2 UTSW 3 145998474 nonsense probably null
R6384:Syde2 UTSW 3 145998813 missense probably damaging 1.00
R6769:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6771:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6970:Syde2 UTSW 3 145988626 missense probably benign 0.15
R6988:Syde2 UTSW 3 146019809 missense probably benign 0.31
R7067:Syde2 UTSW 3 145988264 missense probably benign 0.00
R7146:Syde2 UTSW 3 146007115 nonsense probably null
R7246:Syde2 UTSW 3 145988755 missense probably benign 0.22
R7271:Syde2 UTSW 3 146020276 missense possibly damaging 0.71
R7307:Syde2 UTSW 3 146015798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGCATCAGCTGGCTGTC -3'
(R):5'- TGTAGCATGCTCTCAAATCACAG -3'

Sequencing Primer
(F):5'- GCTGTCAAGCTGGAGCC -3'
(R):5'- CACTCCAAAATAATGATGGCGGTG -3'
Posted On2019-06-26