Incidental Mutation 'R0582:Ctnna2'
ID56463
Institutional Source Beutler Lab
Gene Symbol Ctnna2
Ensembl Gene ENSMUSG00000063063
Gene Namecatenin (cadherin associated protein), alpha 2
Synonymschp, Catna, alpha N-catenin, alpha(N)-catenin, Catna2
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location76881637-77979699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77758417 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 106 (V106L)
Ref Sequence ENSEMBL: ENSMUSP00000124764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075340] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161846] [ENSMUST00000162273]
Predicted Effect probably benign
Transcript: ENSMUST00000075340
AA Change: V93L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063
AA Change: V93L

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159626
AA Change: V93L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063
AA Change: V93L

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
AA Change: V106L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063
AA Change: V106L

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161846
AA Change: V106L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063
AA Change: V106L

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162273
AA Change: V93L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124689
Gene: ENSMUSG00000063063
AA Change: V93L

DomainStartEndE-ValueType
Pfam:Vinculin 18 356 1.8e-106 PFAM
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Animals homozygous for a mutation of this gene exhibit ataxia, reduced body weight, reduced male fertility, and abnormalities of the brain which include a hypoplastic cerebellum, abnormal foliation pattern, ectopic Purkinje cells, and abnormal pyramidal cells in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Ctnna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ctnna2 APN 6 76980761 missense probably damaging 1.00
IGL00573:Ctnna2 APN 6 76902281 intron probably benign
IGL01290:Ctnna2 APN 6 76882560 missense possibly damaging 0.89
IGL01719:Ctnna2 APN 6 77636975 nonsense probably null
IGL01725:Ctnna2 APN 6 77641365 missense possibly damaging 0.89
IGL02381:Ctnna2 APN 6 76954783 missense probably benign 0.27
IGL02561:Ctnna2 APN 6 77845580 missense probably benign 0.34
IGL02653:Ctnna2 APN 6 76980777 missense probably benign 0.00
IGL02658:Ctnna2 APN 6 76980824 missense probably benign 0.00
IGL02721:Ctnna2 APN 6 76981869 missense probably damaging 0.99
IGL03075:Ctnna2 APN 6 76954730 missense probably benign 0.14
IGL03291:Ctnna2 APN 6 76973712 missense probably damaging 1.00
R0379:Ctnna2 UTSW 6 77641440 missense probably benign 0.01
R0423:Ctnna2 UTSW 6 77653069 missense probably damaging 1.00
R0539:Ctnna2 UTSW 6 76973899 missense probably damaging 1.00
R0540:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R0545:Ctnna2 UTSW 6 77605182 missense probably damaging 1.00
R0559:Ctnna2 UTSW 6 76915850 missense probably damaging 1.00
R0607:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R1318:Ctnna2 UTSW 6 76882790 missense probably damaging 1.00
R1754:Ctnna2 UTSW 6 77636749 missense possibly damaging 0.61
R1838:Ctnna2 UTSW 6 77845542 missense probably damaging 0.99
R1924:Ctnna2 UTSW 6 76954847 missense possibly damaging 0.75
R1969:Ctnna2 UTSW 6 77758500 missense probably damaging 0.99
R2011:Ctnna2 UTSW 6 76973791 missense possibly damaging 0.47
R2867:Ctnna2 UTSW 6 77114922 splice site probably benign
R3103:Ctnna2 UTSW 6 77653144 missense possibly damaging 0.66
R3772:Ctnna2 UTSW 6 76973769 missense probably damaging 0.99
R3809:Ctnna2 UTSW 6 76954757 missense probably damaging 0.99
R4023:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4024:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4025:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4026:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4288:Ctnna2 UTSW 6 77605221 missense probably damaging 0.96
R4291:Ctnna2 UTSW 6 76882745 missense probably damaging 1.00
R4493:Ctnna2 UTSW 6 76981848 missense probably damaging 0.99
R4561:Ctnna2 UTSW 6 77636713 critical splice donor site probably null
R4824:Ctnna2 UTSW 6 76980781 missense probably damaging 1.00
R4960:Ctnna2 UTSW 6 77653111 missense probably damaging 1.00
R4999:Ctnna2 UTSW 6 76915762 missense possibly damaging 0.86
R5041:Ctnna2 UTSW 6 76915763 missense probably damaging 1.00
R5093:Ctnna2 UTSW 6 77114929 critical splice donor site probably null
R5411:Ctnna2 UTSW 6 77114931 missense probably damaging 1.00
R5847:Ctnna2 UTSW 6 76973837 missense possibly damaging 0.87
R5874:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R5935:Ctnna2 UTSW 6 77143921 missense probably benign 0.01
R6008:Ctnna2 UTSW 6 76915828 missense probably damaging 1.00
R6115:Ctnna2 UTSW 6 77636839 missense probably benign 0.10
R6369:Ctnna2 UTSW 6 76980695 missense possibly damaging 0.88
R6490:Ctnna2 UTSW 6 77143909 missense probably benign
R7021:Ctnna2 UTSW 6 77636905 missense probably damaging 1.00
R7152:Ctnna2 UTSW 6 76980824 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGGGGCCATTTGCTCTTCACAG -3'
(R):5'- ACAAGCAACAAAGGTCCGTCTGG -3'

Sequencing Primer
(F):5'- CAAAAGTGGGCTCTTTGAACC -3'
(R):5'- CAAAGGTCCGTCTGGTAAAAAG -3'
Posted On2013-07-11