Incidental Mutation 'R7269:Rasgrp4'
ID565148
Institutional Source Beutler Lab
Gene Symbol Rasgrp4
Ensembl Gene ENSMUSG00000030589
Gene NameRAS guanyl releasing protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7269 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29134851-29153961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29148430 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 432 (R432S)
Ref Sequence ENSEMBL: ENSMUSP00000125137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000123416] [ENSMUST00000134176] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000160396] [ENSMUST00000161522] [ENSMUST00000164589] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect probably damaging
Transcript: ENSMUST00000032811
AA Change: R432S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589
AA Change: R432S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094617
AA Change: R433S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589
AA Change: R433S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123416
SMART Domains Protein: ENSMUSP00000122992
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 6 125 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134176
SMART Domains Protein: ENSMUSP00000120165
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 125 5.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144795
SMART Domains Protein: ENSMUSP00000121796
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 5 175 1.7e-30 PFAM
Pfam:DUF2465 172 213 1.3e-14 PFAM
Pfam:DUF2465 211 242 6.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153251
SMART Domains Protein: ENSMUSP00000117500
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 114 1.9e-22 PFAM
Pfam:DUF2465 111 196 1.1e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159351
AA Change: R432S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589
AA Change: R432S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159975
AA Change: R432S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589
AA Change: R432S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160194
AA Change: R422S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589
AA Change: R422S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160396
Predicted Effect probably damaging
Transcript: ENSMUST00000161522
AA Change: R418S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589
AA Change: R418S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164589
SMART Domains Protein: ENSMUSP00000131477
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 8 327 3.8e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203070
AA Change: R340S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589
AA Change: R340S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203380
AA Change: R363S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589
AA Change: R363S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204194
AA Change: R335S

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589
AA Change: R335S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204845
AA Change: R398S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589
AA Change: R398S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205027
AA Change: R243S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589
AA Change: R243S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,472,956 N36I probably damaging Het
A430033K04Rik T A 5: 138,646,752 Y300N possibly damaging Het
Adipor2 T C 6: 119,370,244 Q26R probably benign Het
Ahnak T A 19: 9,006,617 M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
AI837181 C A 19: 5,426,434 S208R probably damaging Het
Akap2 G T 4: 57,855,217 R182L probably damaging Het
Arhgap35 T G 7: 16,561,727 M1138L probably benign Het
Card14 T G 11: 119,337,747 L633R probably damaging Het
Carmil3 A G 14: 55,493,895 T144A probably benign Het
Cbfa2t2 T A 2: 154,515,975 N223K probably benign Het
Ccdc39 T C 3: 33,830,105 I363V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccpg1 G T 9: 73,013,327 R741S probably benign Het
Cenpc1 A G 5: 86,013,507 F855L probably damaging Het
Cenpc1 A T 5: 86,032,418 M665K probably benign Het
Cp A G 3: 19,983,477 H832R probably damaging Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dlc1 A C 8: 36,579,253 L730R probably damaging Het
Dmbt1 A T 7: 131,066,621 I536F unknown Het
Dscam G A 16: 96,678,401 T1182I probably benign Het
Eea1 A T 10: 96,018,138 I553F probably damaging Het
Far1 T C 7: 113,561,447 V400A probably benign Het
Fbrsl1 A T 5: 110,433,014 S126T probably benign Het
Frmpd2 A T 14: 33,522,881 E552V possibly damaging Het
Gm5431 T A 11: 48,888,410 T562S probably benign Het
Gm5475 T C 15: 100,427,009 F106S unknown Het
Gpr12 T C 5: 146,583,378 T245A probably damaging Het
Gsta2 A G 9: 78,332,137 Y166H probably benign Het
H6pd A G 4: 149,982,912 V347A probably benign Het
Ifih1 T C 2: 62,645,633 T100A probably benign Het
Itga2 C T 13: 114,886,689 W59* probably null Het
Kprp A G 3: 92,823,871 V624A probably damaging Het
Lmbrd2 A G 15: 9,194,684 Y591C probably damaging Het
Map7d1 A G 4: 126,232,873 V842A unknown Het
Mboat2 A T 12: 24,831,709 T4S probably benign Het
Mkl2 A T 16: 13,401,034 M515L possibly damaging Het
Muc5b A G 7: 141,857,535 D1406G unknown Het
Mylk G A 16: 34,785,011 G3D probably damaging Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nemp1 G T 10: 127,695,476 R361L probably damaging Het
Nol4 A C 18: 23,039,789 V85G probably benign Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Obscn T C 11: 59,043,012 E5342G probably damaging Het
Olfr1180 C T 2: 88,412,495 M54I possibly damaging Het
Olfr129 C A 17: 38,055,551 C5F probably damaging Het
Olfr1317 T A 2: 112,142,560 F205Y probably damaging Het
Olfr557 T G 7: 102,699,045 L269R probably damaging Het
Olfr77 A G 9: 19,920,335 N42S possibly damaging Het
Pde4dip A G 3: 97,766,959 S214P probably damaging Het
Per3 A T 4: 151,031,936 C278* probably null Het
Pi4k2a T C 19: 42,090,686 L62P probably damaging Het
Plekha7 C A 7: 116,181,212 G126W probably damaging Het
Ppp1r13b T C 12: 111,834,919 K567E probably damaging Het
Pradc1 T A 6: 85,447,566 Q134L probably benign Het
Pwp2 A G 10: 78,176,336 F628L probably benign Het
Rab5c C T 11: 100,716,102 G217D probably benign Het
Rad51ap2 G T 12: 11,456,806 S243I possibly damaging Het
Scn2a T A 2: 65,763,769 L1654Q probably damaging Het
Slc22a28 T A 19: 8,117,127 T177S probably benign Het
Slc25a24 G T 3: 109,158,644 Q272H probably null Het
Slc3a1 A T 17: 85,032,445 I144F probably damaging Het
Smg9 C T 7: 24,406,070 R176C possibly damaging Het
Sorl1 A T 9: 42,037,203 L762Q probably damaging Het
Srebf2 C A 15: 82,204,069 P1079T probably benign Het
Sub1 A T 15: 11,993,851 S4T probably benign Het
Tacr1 A T 6: 82,492,711 Y192F probably benign Het
Tm4sf19 A T 16: 32,405,996 H54L probably damaging Het
Tnxb T C 17: 34,695,454 L1838P probably damaging Het
Trmt1l T C 1: 151,457,788 S681P possibly damaging Het
Ttc30b A G 2: 75,937,494 F305S probably damaging Het
Ttn A G 2: 76,907,832 V4167A unknown Het
Unc13d T A 11: 116,068,230 M702L probably benign Het
Vgll3 A G 16: 65,839,518 H240R probably benign Het
Vmn1r189 C G 13: 22,102,567 W33C probably benign Het
Vmn2r17 G A 5: 109,428,471 A403T possibly damaging Het
Vmn2r2 G A 3: 64,126,577 T508I probably benign Het
Wfs1 G A 5: 36,967,790 Q586* probably null Het
Zbp1 A T 2: 173,213,872 H166Q unknown Het
Zcchc3 G A 2: 152,414,374 A135V probably benign Het
Zfp51 T C 17: 21,463,698 Y192H probably benign Het
Zkscan2 T C 7: 123,489,771 T426A probably benign Het
Other mutations in Rasgrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rasgrp4 APN 7 29148541 splice site probably benign
IGL01145:Rasgrp4 APN 7 29151473 missense possibly damaging 0.83
IGL01806:Rasgrp4 APN 7 29139050 missense possibly damaging 0.83
IGL02023:Rasgrp4 APN 7 29138910 missense probably damaging 1.00
IGL02499:Rasgrp4 APN 7 29151503 utr 3 prime probably benign
IGL02989:Rasgrp4 APN 7 29148406 missense probably damaging 1.00
IGL03281:Rasgrp4 APN 7 29146025 missense possibly damaging 0.69
R0092:Rasgrp4 UTSW 7 29145132 missense possibly damaging 0.74
R0390:Rasgrp4 UTSW 7 29145860 missense probably damaging 1.00
R0614:Rasgrp4 UTSW 7 29145851 missense probably damaging 1.00
R0628:Rasgrp4 UTSW 7 29140210 intron probably benign
R1420:Rasgrp4 UTSW 7 29140345 missense probably damaging 0.98
R1434:Rasgrp4 UTSW 7 29137727 critical splice donor site probably null
R1664:Rasgrp4 UTSW 7 29140263 missense probably benign 0.00
R1911:Rasgrp4 UTSW 7 29138877 missense probably damaging 1.00
R2164:Rasgrp4 UTSW 7 29139045 missense probably damaging 1.00
R4277:Rasgrp4 UTSW 7 29152594 unclassified probably benign
R5024:Rasgrp4 UTSW 7 29148407 missense probably damaging 1.00
R5423:Rasgrp4 UTSW 7 29145136 missense probably damaging 1.00
R5813:Rasgrp4 UTSW 7 29145214 missense probably damaging 1.00
R5823:Rasgrp4 UTSW 7 29137717 missense probably benign 0.00
R6268:Rasgrp4 UTSW 7 29143068 missense probably damaging 1.00
R6285:Rasgrp4 UTSW 7 29148383 missense probably damaging 1.00
R7062:Rasgrp4 UTSW 7 29150194 missense possibly damaging 0.92
Z1088:Rasgrp4 UTSW 7 29150536 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCGTATGGCCAGACAGATCC -3'
(R):5'- TGTTCCACATGCTGACCCAG -3'

Sequencing Primer
(F):5'- ACAGATCCCGAAGTCTCTGGAG -3'
(R):5'- ACCCAGAGTCACGCTGTCTG -3'
Posted On2019-06-26